ID: 1036767932

View in Genome Browser
Species Human (GRCh38)
Location 8:11560709-11560731
Sequence TGCCCCCACGGGGCAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036767925_1036767932 -8 Left 1036767925 8:11560694-11560716 CCAGTGCTCCCTGGGTGCCCCCA 0: 1
1: 2
2: 6
3: 39
4: 347
Right 1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG 0: 1
1: 0
2: 2
3: 19
4: 220
1036767920_1036767932 12 Left 1036767920 8:11560674-11560696 CCTCTGTCCACCTGGATCTGCCA 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG 0: 1
1: 0
2: 2
3: 19
4: 220
1036767921_1036767932 5 Left 1036767921 8:11560681-11560703 CCACCTGGATCTGCCAGTGCTCC 0: 1
1: 0
2: 5
3: 20
4: 261
Right 1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG 0: 1
1: 0
2: 2
3: 19
4: 220
1036767922_1036767932 2 Left 1036767922 8:11560684-11560706 CCTGGATCTGCCAGTGCTCCCTG 0: 1
1: 1
2: 2
3: 37
4: 309
Right 1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG 0: 1
1: 0
2: 2
3: 19
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036767932 Original CRISPR TGCCCCCACGGGGCAGGCGC TGG Intronic
900437833 1:2639926-2639948 GGCCCCCAGGCGGCAGGTGCAGG - Intronic
900514174 1:3073528-3073550 TTCCCGCACGGGGAAGTCGCCGG - Intronic
900615326 1:3563113-3563135 TGCACACAGGGGGCAGGGGCAGG - Intronic
901469259 1:9444272-9444294 AGCTCCCTCCGGGCAGGCGCGGG - Intergenic
901776698 1:11565182-11565204 TGCACCCACAGGGCAAGGGCAGG + Intergenic
901880517 1:12191270-12191292 CAGCCCCACGGGGCAGGCGGTGG + Intronic
903282533 1:22258094-22258116 TGACGCCACGGGGCAGCCGCAGG + Intergenic
903820042 1:26095005-26095027 TGGCCCCAGGGGGCAGGGGCAGG + Intergenic
903850724 1:26304304-26304326 TGCCCAGACAGGGCAGGGGCTGG - Intronic
904477491 1:30774644-30774666 TGCCCCCTCGGGGCGGGCCTGGG - Intergenic
904500128 1:30908534-30908556 GCCGCCCACGGGGCCGGCGCCGG - Exonic
905308643 1:37034962-37034984 GGCTCCCACGCGGCGGGCGCTGG + Intergenic
906275662 1:44513309-44513331 GGCCCCCATGGGCCAGGCTCGGG - Intronic
907442922 1:54489571-54489593 TGCCCCCTAGGGGCCGCCGCCGG + Intergenic
908510162 1:64844826-64844848 TGCCCTCACGGGCCAGGAGGAGG + Exonic
909040829 1:70649336-70649358 TGCCACCACGGGGCAGCAACAGG + Intergenic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
916930833 1:169576575-169576597 TCCTTCCACGGGGCAGGCTCAGG + Intronic
917788886 1:178487029-178487051 GGCGCCCACGGGGCCGGTGCTGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920045138 1:203128004-203128026 TGCCCCCTTGGGGCAGGCCATGG + Intronic
922705411 1:227788002-227788024 TGCCCCGCAGGTGCAGGCGCCGG + Intergenic
922925421 1:229343112-229343134 CGCCCCCACGGAGCGGGCGGAGG - Intronic
923572515 1:235128926-235128948 TTCGCCCACTGCGCAGGCGCAGG - Exonic
923631307 1:235650445-235650467 CGCCCCAACGGCCCAGGCGCTGG - Intronic
1062855618 10:778182-778204 TGCCCCCACCAAGCAGGAGCAGG + Intergenic
1063017913 10:2096614-2096636 TGGCCCCAAAGGGCAGGAGCTGG + Intergenic
1066026222 10:31362512-31362534 TGCCCAGACGGGGCAGGGCCTGG + Intronic
1067704900 10:48599312-48599334 TGTCCCCACGTGGCAGTCCCTGG - Intronic
1073331020 10:102669841-102669863 TGCCTCCAGGGGGCTGGCACAGG + Intergenic
1073577805 10:104640469-104640491 TGCCCCCACGCGGCAGCGCCCGG + Intergenic
1073609673 10:104930683-104930705 AGCCCCCATAGGGCAGGGGCTGG + Intronic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1074428068 10:113369658-113369680 TGCCCCCAGGGGGCATGTGGTGG + Intergenic
1076068790 10:127469538-127469560 TGCCCCCACTGGGTAGGTGGGGG - Intergenic
1076821316 10:132941327-132941349 TGCCCACTCGGGGCAGCTGCAGG + Intronic
1076837890 10:133030236-133030258 GCCCACCACGGGGGAGGCGCCGG + Intergenic
1076849253 10:133085083-133085105 TGCCTCCAAGGGGCAAGCACGGG + Intronic
1077327268 11:1969224-1969246 TGCCCCCACCAGGCAGGCCGAGG - Intronic
1077423886 11:2465571-2465593 GGCCAGCACGGGGCAGGGGCCGG - Intronic
1077464887 11:2729071-2729093 TGCCCGCCTGGGGCAGGCGGGGG - Intronic
1081636336 11:44724993-44725015 TGGCAGAACGGGGCAGGCGCAGG - Intergenic
1082007158 11:47425814-47425836 AGCCCCCACAGGACAGGCCCCGG - Intronic
1083310371 11:61780751-61780773 TCCCCCCAGGGGGCTGGGGCCGG - Exonic
1083441350 11:62678730-62678752 TGCCCCCAGGGAGAAGGCTCTGG - Exonic
1083623000 11:64058239-64058261 AGCACCCTCGGGGCAGGAGCAGG - Intronic
1084007840 11:66332563-66332585 GGGCCCCAGGGGGCAGGCGGTGG + Exonic
1084498369 11:69519202-69519224 TGTGCCCAGGGGGCAGGCCCTGG - Intergenic
1085384924 11:76152083-76152105 AGCTCCCACGGGGCAGGCGCGGG + Intergenic
1091043056 11:132300475-132300497 TGCCCCCACAGTGCAGCCGGGGG + Intronic
1091259715 11:134224740-134224762 GGACCCCACCCGGCAGGCGCAGG + Exonic
1091293887 11:134459144-134459166 TGCCCCAAGGGGTCAGGCCCTGG - Intergenic
1202810250 11_KI270721v1_random:24404-24426 TGCCCCCACCAGGCAGGCCGAGG - Intergenic
1091996721 12:4999704-4999726 TGCCCAGAGAGGGCAGGCGCTGG - Intergenic
1092143690 12:6200660-6200682 TGCCCGCACCGGGCAGGCACCGG + Intronic
1092247942 12:6873597-6873619 CGCCCCCACGGCGAAGGCCCGGG + Intronic
1094508924 12:31084481-31084503 TGCCCCCAGTGAGGAGGCGCCGG + Intronic
1094855519 12:34401164-34401186 CCTCCCCACTGGGCAGGCGCGGG + Intergenic
1095097597 12:38156638-38156660 GACCCCCCCGGGACAGGCGCAGG - Intergenic
1097232847 12:57522828-57522850 GGCCCCCATGGCGCATGCGCGGG + Exonic
1098933905 12:76454913-76454935 TGCCCTCTTGGGGCAGGCTCAGG + Intronic
1099480285 12:83157236-83157258 TGCAACCACGGGGCAGGAGAGGG - Intergenic
1099826647 12:87784431-87784453 TGTCCCCAGGGGGCAGGCGAGGG - Intergenic
1101983558 12:109428202-109428224 TGCCACCAGGGGGCAGCCGTGGG + Intronic
1103308860 12:119989130-119989152 TGCCCGCGCGCGTCAGGCGCCGG + Intergenic
1109149263 13:58823893-58823915 GGCGCTCGCGGGGCAGGCGCGGG - Intergenic
1110219869 13:73060519-73060541 AGACCCCACGGAGTAGGCGCTGG - Intronic
1111232527 13:85363046-85363068 GGCCCCCACGGAGCAGCAGCGGG - Intergenic
1113483759 13:110640124-110640146 AGCCACCACGGGAGAGGCGCTGG - Intergenic
1113561311 13:111283627-111283649 TGCCGCCAGGGGCCAGGAGCTGG + Intronic
1113576879 13:111401380-111401402 CTCCCCCACGGGGCAGGACCTGG + Intergenic
1113783205 13:112988358-112988380 TCCCCACACCGGGCAGGTGCTGG - Intronic
1113893537 13:113749020-113749042 GGCGCCCACGGGGCAGGCTCCGG + Intergenic
1113927932 13:113951574-113951596 TGCAGCCTTGGGGCAGGCGCTGG - Intergenic
1113927957 13:113951644-113951666 TGCAGCCTTGGGGCAGGCGCTGG - Intergenic
1114073101 14:19131479-19131501 TGCCCCCTCGGGGCGGGCCTAGG + Intergenic
1114089165 14:19268504-19268526 TGCCCCCTCGGGGCGGGCCTAGG - Intergenic
1114736559 14:25049324-25049346 TGCCCCCAGGGCGCTGGCCCTGG - Intronic
1119389818 14:74283550-74283572 TTCCCCTACGTGGCAGGCTCAGG + Intergenic
1122337833 14:101005538-101005560 TTCTCCCAGGGAGCAGGCGCTGG + Intergenic
1124240752 15:28025708-28025730 TGCCCTCACGGAGCAGCCGGTGG - Intronic
1124692773 15:31839229-31839251 TTCCCACAGTGGGCAGGCGCTGG + Intronic
1126422529 15:48489975-48489997 TGCCCCGACGGAGCAGCAGCAGG + Exonic
1129292766 15:74581078-74581100 TGCCCAGATGGGGCAGGGGCAGG - Intronic
1129851383 15:78795807-78795829 GGCACCCACAGGGCAGGAGCAGG + Intronic
1131969242 15:97875656-97875678 GGCCCCCACAGCGCAGCCGCGGG - Intergenic
1132205150 15:99981341-99981363 TGCCCCCATGAGGCAGGGCCAGG + Intronic
1132500442 16:282517-282539 TGCCCTCACCGCGCAGGCCCCGG - Exonic
1132783403 16:1641369-1641391 TCCCTCCCCGGGGCAGGCACAGG - Intronic
1132853854 16:2036205-2036227 TGCCCCCCACGGGCAGGCCCAGG - Intronic
1139088583 16:63617577-63617599 TGCCCCCACAGCGCAGCGGCGGG + Intergenic
1140194610 16:72846100-72846122 TGCTCTCATGGGGCAGGGGCAGG + Intronic
1140347416 16:74227707-74227729 TGACCCCAGGAGGCAGGGGCTGG + Intergenic
1141557902 16:84848112-84848134 TGGCCCCCCGGGGCAGCCGCGGG + Intronic
1141694660 16:85613813-85613835 TGCGCCCCCGCGGCAGGTGCTGG + Intronic
1142292486 16:89199449-89199471 TGCCCCCGTGGAGTAGGCGCAGG + Exonic
1142345286 16:89550104-89550126 TGACCACACGGGGCAGGAGCAGG + Intronic
1144968076 17:19090198-19090220 GGCCCACCCGGGGCAGGTGCTGG + Intergenic
1144979841 17:19161865-19161887 GGCCCACCCGGGGCAGGTGCTGG - Intergenic
1144988381 17:19216367-19216389 GGCCCACCCGGGGCAGGTGCTGG + Intronic
1146439062 17:32877351-32877373 CGCCCCCTGGGGACAGGCGCTGG + Intergenic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1148467212 17:47872426-47872448 TCCCCCCACGGCCCAGACGCAGG - Intergenic
1148786829 17:50149723-50149745 TCCCCCGACGGGGCGGGCGGCGG + Exonic
1148830109 17:50425840-50425862 TGCCCCCTCGGGTCACGTGCTGG - Intergenic
1151181317 17:72330865-72330887 TGCACCCAAGAGGCAGGCGCTGG + Intergenic
1152071268 17:78134890-78134912 TGACCCCAGGGGGCAGGTACTGG - Exonic
1152378932 17:79932224-79932246 TGCTGCCACGGGGCGGGCTCTGG - Intergenic
1152695306 17:81741134-81741156 TGCCCAGAGGGGGCAGGCGTGGG - Intergenic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1157606977 18:48932003-48932025 TGCCCCCACTGAGCAGGAGATGG + Intronic
1159901122 18:74046680-74046702 TGTCCCCACGTGGCAGGGGAAGG - Intergenic
1160541924 18:79628581-79628603 TGGCCCCAGGAGGCAGGGGCAGG - Intergenic
1160753767 19:747468-747490 TGCCCCCACCCGGGAGGGGCCGG + Exonic
1160793774 19:934585-934607 TACACCCAGGGGGCAGGTGCGGG - Intronic
1161216772 19:3098622-3098644 TGCCCCGTGGGGGCTGGCGCAGG - Intronic
1161455956 19:4369812-4369834 GTCCCCCACGGGCCAGGCACTGG + Intronic
1162421646 19:10568905-10568927 GGCCCCCAAGGGGCGGGCGCCGG - Exonic
1162584684 19:11551728-11551750 TGCTCCCCCTGGGCCGGCGCGGG + Intronic
1165882461 19:39053542-39053564 GGCCCCCACAGGGCTGGCACGGG + Intergenic
1166704978 19:44903511-44903533 TGCCCCCTCGGGGCGGGCCCAGG - Exonic
1168101916 19:54145899-54145921 TGCCCCCACAGCACAGGCGCTGG + Exonic
1168282279 19:55312066-55312088 TGACCCCACGGGGCCGGGGAGGG + Exonic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
925069649 2:956287-956309 TGCCCAGCAGGGGCAGGCGCAGG - Intronic
925264913 2:2560332-2560354 TGCCACTTCGGGGCTGGCGCAGG + Intergenic
927213212 2:20651150-20651172 TGCCACCAGGGGGCAGGCCAGGG - Intergenic
927518315 2:23684907-23684929 TGCCCCCACCGGGCCAGAGCAGG + Intronic
932063134 2:68527927-68527949 TGCCCAGACGGGGCAGGGCCCGG + Intronic
932505009 2:72220391-72220413 TGCCCCCAGGGGGCATGAGGAGG - Intronic
933703459 2:85272862-85272884 TGCAGCCACAGGGCAGGAGCGGG + Intronic
943033750 2:182716016-182716038 TCCCCGCCCGCGGCAGGCGCCGG + Intergenic
947632295 2:231662121-231662143 GGCGCCCAGGGCGCAGGCGCCGG - Intergenic
948806856 2:240456760-240456782 TGCCCCCACGGGGGTGGGACTGG + Intronic
948920933 2:241065626-241065648 TGCCCTCGAGGGGCAGGGGCTGG - Intronic
949027800 2:241774535-241774557 GGCCACCTCGGGGCAGGGGCAGG - Intergenic
949043331 2:241859212-241859234 TGCCCCCACCCGGCAGCCTCAGG - Intergenic
1171359542 20:24577398-24577420 TGCCCCGATGGTGCAGGTGCTGG + Intronic
1172702791 20:36863262-36863284 TTCCTCTCCGGGGCAGGCGCGGG + Exonic
1174385475 20:50186407-50186429 TGCCCCCAGGTGGCAGGTTCTGG - Intergenic
1175433148 20:58921486-58921508 TGCCCCCACGAGGAAGGCCCTGG + Intergenic
1176077284 20:63254269-63254291 TCCCCCCTCGGAGCTGGCGCGGG + Intronic
1176083802 20:63286784-63286806 TGCCCCCACGTAGGAGGAGCTGG + Intronic
1179142085 21:38734481-38734503 TGCAGCCGCGGTGCAGGCGCAGG + Intergenic
1179885906 21:44314216-44314238 TGCCCCCAGTGGGCAGGAGGCGG + Intronic
1179980432 21:44892949-44892971 CGCCCCCTGGGGGCAGACGCCGG - Intronic
1180491542 22:15853832-15853854 TGCCCCCTCGGGGCGGGCCTAGG + Intergenic
1180848684 22:18999156-18999178 CGCCCCCTCGGGGCAGCTGCAGG - Intergenic
1181003647 22:19999426-19999448 TGCCCCCACAGGGCAGTGCCTGG + Intronic
1183590335 22:38776131-38776153 TTCCCCCACTTGGCAGGCACTGG - Intronic
1184477529 22:44729666-44729688 GGCCCCCACAGGACAGGCCCCGG + Intronic
1185221221 22:49630104-49630126 TGCGTCCACAGGGCAGGTGCTGG + Intronic
950545347 3:13634859-13634881 CAACCCCACGGGGCAGGTGCAGG - Intronic
950930476 3:16783975-16783997 TGTCCCCACTGGGCAGAAGCAGG - Intergenic
952342779 3:32459622-32459644 TGCACCCATGGGGGAGGAGCAGG + Intronic
954462422 3:50634900-50634922 TGCCCCCATGGAGCAGCCTCTGG - Intronic
963368122 3:144364442-144364464 TGCCACCATGGGCCAGGAGCAGG - Intergenic
964812210 3:160677817-160677839 TGCCCTCACAGGGGAGGGGCTGG + Exonic
966681473 3:182645914-182645936 TGGCCCCAAAGGGCAGGAGCTGG - Intergenic
966874452 3:184314528-184314550 CGCCCCCACGTGACCGGCGCAGG - Intronic
967983103 3:195077351-195077373 TGCCCCCACTGGGCTGGTCCGGG + Intronic
968068991 3:195774272-195774294 TTCCCCTATGGGGCAGGCGCCGG - Exonic
968082041 3:195853195-195853217 TCCCTCGACGGCGCAGGCGCGGG + Intergenic
968137034 3:196227128-196227150 TCCCCCCACAGGGCAGCCCCGGG - Intronic
968213399 3:196868024-196868046 TGCCGCGACGGGGCCGGCGGCGG + Exonic
968547967 4:1208235-1208257 GGCCCCCACGGGGCAAGTTCTGG + Intronic
968811199 4:2800411-2800433 AGCAGCCACGGGGCAGGCTCGGG - Intronic
968907574 4:3461801-3461823 GGCCCCCAAGGGGCTGGCCCAGG - Intergenic
969111730 4:4848687-4848709 TGCCTACACTGGGCAGGTGCTGG + Intergenic
969705284 4:8788371-8788393 TATCCCCACGGGCCTGGCGCTGG - Intergenic
969872997 4:10116404-10116426 TGCCCCCAAGGGCCTGGCCCGGG - Intronic
971257973 4:25031029-25031051 GGGCGCCACGGGGCCGGCGCTGG - Intergenic
971451767 4:26807389-26807411 GTCCCCCACGGGCCAGGTGCTGG + Intergenic
973317828 4:48780013-48780035 TCCAGCCCCGGGGCAGGCGCCGG - Intronic
979231550 4:118353060-118353082 TGCCCCCTGGGGGCGGGCGCCGG + Intergenic
983885348 4:172975043-172975065 TGCCCCCACGTGGCAAGCAGGGG + Intronic
985062415 4:186092483-186092505 GGCACCCACGGGGCGGGTGCGGG - Intergenic
985487629 5:160438-160460 TTTCCCCACGGGGCAGCCGGCGG - Intronic
985532783 5:443586-443608 TTCCCCCACGCCCCAGGCGCTGG + Intronic
985655763 5:1130675-1130697 TGCTCCCTCTGGGCAGGCACAGG - Intergenic
986297183 5:6449186-6449208 GGCCTCCACGGTGTAGGCGCTGG - Exonic
988683291 5:33503481-33503503 TGCCCCCTTGGAGCAGGCCCAGG - Intergenic
990174541 5:53092416-53092438 TGCCACCACGGGCCAGGCCAGGG - Exonic
992676743 5:79112527-79112549 TGCACCCAAGGCCCAGGCGCTGG + Intronic
996978539 5:129461624-129461646 TGCCCCCGTGGGGCCGGGGCCGG - Exonic
997329275 5:133047465-133047487 GGCCCCCACAGCGCAGGGGCGGG - Intergenic
1001396004 5:171419964-171419986 TGCGCCCTCCGGGCTGGCGCAGG - Exonic
1002712700 5:181204764-181204786 TGCTCTCCCGGGGCAGCCGCGGG + Exonic
1003176811 6:3758083-3758105 GGCCCCCACGGTGCAGCGGCGGG - Intergenic
1003224532 6:4191729-4191751 GGCTCCCACGGTGCAGGGGCGGG + Intergenic
1004607250 6:17206377-17206399 TCCCCCCGCGGCCCAGGCGCAGG - Intergenic
1005243406 6:23855725-23855747 TGCCCAGACGGGGCAGGGCCTGG - Intergenic
1005853655 6:29843478-29843500 TGCCCCAAGGGGGCAGCTGCTGG + Intergenic
1006840859 6:37027179-37027201 TGCCCACAAGGGGCAGGTGCCGG - Intronic
1011983976 6:93419257-93419279 TGCACACACAGGGGAGGCGCAGG - Exonic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1018057807 6:160067637-160067659 TGCCACCACGGAGCAGGAACGGG - Intronic
1019407619 7:891958-891980 CGCCCGCACCGGTCAGGCGCTGG - Intronic
1020002218 7:4762435-4762457 GGCCCCCAGGGGCCAGGCACCGG + Exonic
1020094711 7:5361864-5361886 GGGCCCCACGGGGCGGGCGGGGG + Intronic
1022487558 7:30791394-30791416 TGCCCCCATGGGACAGGGCCAGG + Exonic
1023913123 7:44569272-44569294 TTCCCCCAAGGGGGAGGTGCAGG - Intronic
1024520898 7:50303879-50303901 CGCCCCCACGGGTTACGCGCGGG + Intergenic
1026953807 7:74364408-74364430 GGCCCCCCCGGGGAAGGGGCTGG + Intronic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029283804 7:99452858-99452880 TGACACCACTGGGCAGGAGCAGG + Intronic
1029414237 7:100433059-100433081 TGCCCCCAGGGCGTAGGTGCCGG - Exonic
1029625501 7:101718156-101718178 TTCCCCCACGGGGCTGGCGCAGG - Intergenic
1033372570 7:140724202-140724224 TGCCTCCGTGGGGCAGGGGCAGG - Intronic
1034266947 7:149785652-149785674 TGGCCCCACAGGGCAGGTTCTGG - Intergenic
1034335967 7:150323612-150323634 TGGCCCCCCGGGGCCGGCACGGG - Intronic
1034494108 7:151409954-151409976 CGCGCCCACGGGGCTGGGGCGGG + Intronic
1034531101 7:151696996-151697018 TGCCCCCAGAGCGCAGGCCCAGG + Intronic
1035169680 7:157010520-157010542 GGCCCGCACGGAGGAGGCGCCGG - Exonic
1035567215 8:649679-649701 TGCCTCCAGGAGGCAGGAGCTGG + Intronic
1036767932 8:11560709-11560731 TGCCCCCACGGGGCAGGCGCTGG + Intronic
1037951038 8:23018958-23018980 AGCCCCCATGGGGCAGCAGCTGG + Intronic
1039579383 8:38651278-38651300 ACCCCCTACAGGGCAGGCGCAGG + Intergenic
1039885162 8:41650251-41650273 TACCCCCACGTGGCAGGCTTTGG - Intronic
1040107186 8:43547693-43547715 TCCCCCCACGAGTCTGGCGCAGG + Intergenic
1040471566 8:47738672-47738694 TGGTCCCACGGTGGAGGCGCGGG - Exonic
1047206589 8:122807157-122807179 GGCTCCTACTGGGCAGGCGCAGG + Intronic
1048363048 8:133714746-133714768 TGCCCTGACGGGCCAGGCTCAGG - Intergenic
1049194443 8:141307907-141307929 TGCCCCCACCCGGCTTGCGCTGG - Intronic
1049637498 8:143696916-143696938 TGCCCCTGCGGGGCAGGCCCTGG + Intronic
1051593985 9:18805680-18805702 TGCCTGCAGGGGGCAGGGGCAGG - Intronic
1052413541 9:28149541-28149563 TGCCCAGACGGGGCAGGGCCCGG - Intronic
1057042424 9:91857315-91857337 TGACCTCACTGGGCAGGCGGTGG + Intronic
1060818209 9:126646589-126646611 TGGCCCCACGGGAGAGGGGCAGG - Intronic
1060852705 9:126890396-126890418 TGCCCCCACAGGGCTGGCAAAGG + Intergenic
1060939443 9:127535208-127535230 GGCCCTCACGGAGCAGGCCCTGG + Intronic
1061721956 9:132557350-132557372 TGCCCCCACGGCGGTGGCTCTGG - Intronic
1062461892 9:136665756-136665778 GGCCCCCACGGCGCGGGCTCGGG + Intronic
1187507291 X:19887805-19887827 GGCCGCGTCGGGGCAGGCGCCGG + Intergenic
1189356564 X:40314089-40314111 TGCCACCAAGGGGCAGAAGCAGG + Intergenic
1189491309 X:41473509-41473531 GGCCCCCACGGCCCAGGCGCTGG - Exonic
1190214917 X:48473701-48473723 TGCCCCCACCGGGAAAGAGCTGG + Intergenic
1191252039 X:58264357-58264379 TGCCCCCGTGGGACAGGTGCAGG - Intergenic
1191253794 X:58271234-58271256 CCCCCCCCCGGGTCAGGCGCAGG + Intergenic
1192148500 X:68697574-68697596 TGGCCTCAGGGGCCAGGCGCAGG - Intronic
1200237223 X:154473464-154473486 TGGCCCCACAGGGCGGGCACTGG - Exonic
1200831120 Y:7689533-7689555 GGCCCTCAGGGGGCATGCGCCGG + Intergenic