ID: 1036768534

View in Genome Browser
Species Human (GRCh38)
Location 8:11563877-11563899
Sequence CGGCAGAGGAGACCGCAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036768534_1036768542 13 Left 1036768534 8:11563877-11563899 CCCGCTTGCGGTCTCCTCTGCCG 0: 1
1: 1
2: 0
3: 8
4: 108
Right 1036768542 8:11563913-11563935 CCCCGAGGTCATCCGCAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 45
1036768534_1036768540 -2 Left 1036768534 8:11563877-11563899 CCCGCTTGCGGTCTCCTCTGCCG 0: 1
1: 1
2: 0
3: 8
4: 108
Right 1036768540 8:11563898-11563920 CGCAGGGATGAGCAACCCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1036768534_1036768545 20 Left 1036768534 8:11563877-11563899 CCCGCTTGCGGTCTCCTCTGCCG 0: 1
1: 1
2: 0
3: 8
4: 108
Right 1036768545 8:11563920-11563942 GTCATCCGCAACCTGGAGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036768534 Original CRISPR CGGCAGAGGAGACCGCAAGC GGG (reversed) Intronic
900231863 1:1563101-1563123 TGGCAGAGGAGACAGCAGGGAGG + Intronic
900703912 1:4063995-4064017 CTGCAGAGGATGCCTCAAGCTGG - Intergenic
901031352 1:6308705-6308727 AGGCAGAGGGAACCGCAACCAGG + Intronic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
904202242 1:28828075-28828097 GGGCAGAGGAAACTGAAAGCTGG - Intronic
904351018 1:29906793-29906815 GGGCCGAGGAGACCTCAGGCTGG - Intergenic
904480024 1:30787792-30787814 CGGCAGAGGAGCCAGGAAGCAGG - Intergenic
907787082 1:57623185-57623207 CGGCAGAGCTGACAGGAAGCAGG + Intronic
908088508 1:60662060-60662082 AGGCAGAGGAGACCCCAAAGAGG - Intergenic
910431430 1:87163226-87163248 AAGCAGAGGTGACTGCAAGCAGG - Intronic
911059848 1:93738530-93738552 CGGCAGAGCTGACCGCAGGTCGG + Intronic
916440764 1:164822289-164822311 CAGCAGCGGTGACAGCAAGCTGG + Intronic
922586793 1:226739224-226739246 CGGCAGTGGCGACGCCAAGCCGG + Intronic
922849852 1:228723301-228723323 CAGGAGAGGAGACCCCAAGTGGG + Intergenic
1072743371 10:97923523-97923545 CGGCAAGGAAGACCTCAAGCAGG + Intronic
1075375492 10:121975061-121975083 CGACAAAGGGGACCGCGAGCGGG + Exonic
1075725496 10:124608717-124608739 TGGCCGAGGACACGGCAAGCTGG - Intronic
1076357220 10:129861888-129861910 CGGCCTGGGAGACAGCAAGCTGG + Intronic
1076882711 10:133247426-133247448 CGGCCGAGGAGAAAGGAAGCAGG + Intergenic
1077434372 11:2531710-2531732 AGGCAGAGGGGACTGCAAGGGGG - Intronic
1077710152 11:4528244-4528266 CAGCAGAAGAGATAGCAAGCAGG - Intergenic
1081659018 11:44876513-44876535 TGGCTGAGGAGACATCAAGCTGG + Intronic
1082005142 11:47415054-47415076 CTGCAGAGGAGACGGCAGCCTGG + Exonic
1086960888 11:92979348-92979370 CAGCAGTGGAGACAGCCAGCGGG + Intronic
1089624493 11:119742551-119742573 GGGGAGAGGAGACCGCACACTGG - Intergenic
1090400133 11:126443650-126443672 TGGCTGAGGAGACACCAAGCTGG + Intronic
1090833801 11:130439201-130439223 GGGGAGAGGAGACAGCAAGGAGG - Intergenic
1093478971 12:19584928-19584950 GGGCAGAGGAAACCGCATCCTGG - Intronic
1097267851 12:57755938-57755960 TGTCAGCGGAGACCGCGAGCAGG + Intronic
1103184407 12:118943865-118943887 AGGCAGAGGAGGCAGCAAGTTGG + Intergenic
1104809256 12:131610727-131610749 AGGCAGAGGAGCTGGCAAGCGGG - Intergenic
1108144405 13:47461958-47461980 AGGCAGAGGAGAGAGCAAGAGGG - Intergenic
1110554818 13:76847627-76847649 AGGCAAAGGAGACAGGAAGCAGG - Intergenic
1113307119 13:109090613-109090635 CAGCAGAGGAGACCCACAGCAGG + Intronic
1113592863 13:111513018-111513040 CGGCTGAGGTGACCCCACGCTGG + Intergenic
1115641398 14:35337715-35337737 CTCCAGAGGAGAACGCAAGTGGG + Intergenic
1116168285 14:41363255-41363277 AGGCAGAGGAGATTGCAAGTGGG - Intergenic
1116605611 14:46989763-46989785 TGGCAGAGGAGACAGCTGGCAGG + Intronic
1123405166 15:20015684-20015706 CGGCAGAGATGACGGCAAGTTGG - Intergenic
1123514495 15:21022332-21022354 CGGCAGAGATGACGGCAAGTTGG - Intergenic
1126113283 15:45187744-45187766 CGGCGGAGGGGGCAGCAAGCCGG - Intronic
1129051808 15:72787107-72787129 CTGCAGAAGAGAACCCAAGCAGG - Intergenic
1129073724 15:72973569-72973591 AGGCAGAGGAGACTGGCAGCAGG - Intergenic
1134772073 16:16817858-16817880 CAGCAGATGATACCGAAAGCTGG + Intergenic
1134776352 16:16857001-16857023 CTGCATAGGAGACAGCAAGATGG - Intergenic
1142132702 16:88438162-88438184 TGGCAGAGGAGACTGCGCGCTGG + Exonic
1147923121 17:43930904-43930926 TGACAGAGGAGAGAGCAAGCAGG - Intergenic
1148341306 17:46875120-46875142 CGGCAGAGGACACCGCGTACAGG - Exonic
1151880763 17:76893179-76893201 GGGCAGAGGAGAGAGCAACCTGG - Intronic
1152134727 17:78497215-78497237 TTCCAGAGGAGACCTCAAGCAGG - Intronic
1152492845 17:80649392-80649414 CGGCAGGGCAGACAGCAAGACGG - Intronic
1157404773 18:47413691-47413713 GGGCTGAGGAGACCTCAGGCAGG - Intergenic
1158546504 18:58402390-58402412 GGGCAGAGGAGATAGCTAGCGGG + Intergenic
1159941192 18:74410292-74410314 CGGCAGAGGGAACCGCAGGAGGG - Intergenic
1163017429 19:14464962-14464984 AGGCAGAGGTTACCGCAAGCTGG + Intronic
1168071275 19:53953383-53953405 CAGCAGAGGACACAGCCAGCCGG - Intergenic
925096577 2:1209047-1209069 AGGCAGAGGAGGCTGCATGCGGG - Intronic
925600872 2:5607663-5607685 GTGCAGAGGAGCCCTCAAGCAGG - Intergenic
929040162 2:37736927-37736949 CGGCAGGAGAGACAGCATGCAGG + Intronic
946167885 2:217876448-217876470 AGGCAGAGGTGCCCGCAAGGAGG + Intronic
948622619 2:239246058-239246080 GGGCAGAGGAGACTGCAGGGGGG + Intronic
1171423063 20:25031984-25032006 TGGGAGTGAAGACCGCAAGCAGG + Intronic
1174197682 20:48785279-48785301 TGTCAGAGGAGACCCCAGGCAGG - Intronic
1176520342 21:7819496-7819518 CCGCAGCGGTGACGGCAAGCTGG - Exonic
1178607913 21:34055495-34055517 CGGCAGAGGTGACCCAAAGCTGG + Intergenic
1181274942 22:21682370-21682392 TGGCACAGGGGACTGCAAGCAGG - Intronic
1182415961 22:30221591-30221613 GGGCCGAGGAGACAGGAAGCTGG - Intergenic
1184773197 22:46609970-46609992 AGGCAGAGGAGCCAGCAAGGAGG - Intronic
949561627 3:5208002-5208024 GGGCAGAGGAGAGCCCAGGCAGG + Intronic
953989821 3:47475638-47475660 CGGCCCTGGAGACCGCAGGCCGG - Intronic
954609712 3:51937850-51937872 CAGCAGAGGGGAGGGCAAGCTGG + Intronic
957329125 3:78737242-78737264 AGGCAGAGGAGATAGAAAGCTGG + Intronic
960055952 3:113276468-113276490 AGGCTGAGGAGACCCCAGGCTGG - Intronic
963870547 3:150409761-150409783 CGGCGGATGAGCCCGCGAGCTGG - Exonic
965404310 3:168250238-168250260 CGGGAGCGGAGACCGCGACCGGG + Intergenic
965647444 3:170898504-170898526 CAGCAGGAGAGACAGCAAGCAGG - Intronic
968284793 3:197502182-197502204 GGGCAGAGGGCACAGCAAGCTGG + Intergenic
968497912 4:928576-928598 TGGCAGGGGAGGCCGCATGCTGG - Intronic
968583941 4:1407247-1407269 CGCAAAAGGAGACCCCAAGCGGG - Intergenic
968743004 4:2340759-2340781 CGGCAGAGGACACCCCAACCAGG + Intronic
968929936 4:3573488-3573510 CTGCAGAGGAGACACCAAGCGGG - Intergenic
975440143 4:74400618-74400640 AGCCAGAGAACACCGCAAGCAGG + Intergenic
975706072 4:77113169-77113191 CGGCAGCGCAGACAGCGAGCTGG - Intergenic
975985509 4:80198122-80198144 TGGCAAAGGCGACCGCACGCGGG + Intronic
976267237 4:83195685-83195707 CGAAAGAGGAGACCCCAAGTGGG - Intergenic
977871266 4:102093362-102093384 CAGCAGAGGACACAGCAAGCAGG + Intergenic
979484367 4:121254093-121254115 GGGCAAAGGAGAGTGCAAGCAGG - Intergenic
992052638 5:72955692-72955714 CGGCAGTGGAGTCGGCAGGCTGG - Intergenic
995654062 5:114404572-114404594 GGGCATAGGAGAAGGCAAGCCGG - Exonic
996310279 5:122096575-122096597 CGAAAGAGGAGACCCCAAGTGGG - Intergenic
997856867 5:137380617-137380639 TGGCAGAGGAGAGAGCAAGGGGG + Intronic
998770753 5:145542171-145542193 AAGCAGAGGAGACCGAAAGGTGG - Intronic
1007904725 6:45448162-45448184 CTGCAGAGGAGAAAGCAAACGGG + Intronic
1016378666 6:143450584-143450606 CGGCAGAGGAGACCGAAAAGTGG - Exonic
1018690072 6:166337503-166337525 CGGCAGAGGAGACCCCAAGCAGG - Intronic
1019383697 7:741477-741499 CGGCAGAGGGGAGCGCCAGGAGG + Intronic
1019456552 7:1130613-1130635 CGGCAGAGGAGACTGGGAGCTGG - Intronic
1021716779 7:23469024-23469046 CGGCAGGGGAGACCACGAACGGG + Intronic
1023838252 7:44080859-44080881 CAGCAGAGGAGGCCGTCAGCTGG - Exonic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024530524 7:50388502-50388524 TGGCAGAGGAGACAGCACTCTGG - Intronic
1024629961 7:51238768-51238790 CTGCAGAGGAGACAGCAGTCAGG - Intronic
1027561596 7:79739160-79739182 AGGCAGAGGAGGCCGCGAGACGG - Intergenic
1029535588 7:101155425-101155447 CTGCAGAACAGACAGCAAGCTGG - Intronic
1034466560 7:151233193-151233215 CTGCTGAGGAGACAGCAGGCGGG - Exonic
1036768534 8:11563877-11563899 CGGCAGAGGAGACCGCAAGCGGG - Intronic
1040280651 8:46040192-46040214 GGGCAGGGCAGACCGCCAGCAGG + Intergenic
1042614562 8:70634092-70634114 AGGCAGAGGTGACGACAAGCAGG + Intronic
1049721271 8:144116540-144116562 GGGCAGAGGAGACCCATAGCGGG + Exonic
1052759601 9:32576833-32576855 AGGCAGGGGAGACAGCAAGTGGG + Intergenic
1054460344 9:65458983-65459005 CTGCAGAGGAGACACCAAGTGGG + Intergenic
1058334577 9:103810402-103810424 AGGCAGAGGGGACAGCAAGGAGG - Intergenic
1059666507 9:116451138-116451160 AGGCAGAGGTGACAGCAACCTGG + Intronic
1060224458 9:121782717-121782739 GGGCAGAAGAGACTGCACGCTGG + Intronic
1061592587 9:131607525-131607547 CCACAGAGAAGACAGCAAGCAGG + Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1188477681 X:30604472-30604494 TGGCAGACAAGACGGCAAGCAGG - Intergenic
1198111945 X:133509663-133509685 GGGCAGAGGAGACCCTAAGAGGG + Intergenic