ID: 1036768928

View in Genome Browser
Species Human (GRCh38)
Location 8:11565751-11565773
Sequence CTTTAAGGAGGTCTGGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036768918_1036768928 8 Left 1036768918 8:11565720-11565742 CCGTGGGCAAGCACTGGATGGGA No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768913_1036768928 16 Left 1036768913 8:11565712-11565734 CCCACTGACCGTGGGCAAGCACT No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768908_1036768928 26 Left 1036768908 8:11565702-11565724 CCTCACAGCCCCCACTGACCGTG No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768912_1036768928 17 Left 1036768912 8:11565711-11565733 CCCCACTGACCGTGGGCAAGCAC No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768911_1036768928 18 Left 1036768911 8:11565710-11565732 CCCCCACTGACCGTGGGCAAGCA No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768914_1036768928 15 Left 1036768914 8:11565713-11565735 CCACTGACCGTGGGCAAGCACTG No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data
1036768907_1036768928 27 Left 1036768907 8:11565701-11565723 CCCTCACAGCCCCCACTGACCGT No data
Right 1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036768928 Original CRISPR CTTTAAGGAGGTCTGGGGGG GGG Intergenic
No off target data available for this crispr