ID: 1036769233

View in Genome Browser
Species Human (GRCh38)
Location 8:11567237-11567259
Sequence CTGGAGATCTTGAAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036769221_1036769233 17 Left 1036769221 8:11567197-11567219 CCACCTCTCCTCCGGCTTGGTTT No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data
1036769226_1036769233 6 Left 1036769226 8:11567208-11567230 CCGGCTTGGTTTTCCTGGGAAAG No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data
1036769222_1036769233 14 Left 1036769222 8:11567200-11567222 CCTCTCCTCCGGCTTGGTTTTCC No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data
1036769220_1036769233 18 Left 1036769220 8:11567196-11567218 CCCACCTCTCCTCCGGCTTGGTT No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data
1036769230_1036769233 -7 Left 1036769230 8:11567221-11567243 CCTGGGAAAGGTGAGGCTGGAGA No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data
1036769225_1036769233 9 Left 1036769225 8:11567205-11567227 CCTCCGGCTTGGTTTTCCTGGGA No data
Right 1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036769233 Original CRISPR CTGGAGATCTTGAAGGATGA GGG Intergenic
No off target data available for this crispr