ID: 1036769888

View in Genome Browser
Species Human (GRCh38)
Location 8:11571703-11571725
Sequence CACCGAGCTGTGTGATGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036769879_1036769888 28 Left 1036769879 8:11571652-11571674 CCCCACGCTCACAGACACAGATG No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data
1036769885_1036769888 -9 Left 1036769885 8:11571689-11571711 CCTGCCGGTCACACCACCGAGCT No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data
1036769881_1036769888 26 Left 1036769881 8:11571654-11571676 CCACGCTCACAGACACAGATGCT No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data
1036769880_1036769888 27 Left 1036769880 8:11571653-11571675 CCCACGCTCACAGACACAGATGC No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data
1036769883_1036769888 -7 Left 1036769883 8:11571687-11571709 CCCCTGCCGGTCACACCACCGAG No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data
1036769884_1036769888 -8 Left 1036769884 8:11571688-11571710 CCCTGCCGGTCACACCACCGAGC No data
Right 1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036769888 Original CRISPR CACCGAGCTGTGTGATGTGC TGG Intergenic
No off target data available for this crispr