ID: 1036770412

View in Genome Browser
Species Human (GRCh38)
Location 8:11575020-11575042
Sequence ACAGGGACGATAAGCGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036770412_1036770425 10 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770412_1036770422 3 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770412_1036770418 0 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770418 8:11575043-11575065 CCCTGTGCCAGAGAGGCTGCTGG No data
1036770412_1036770423 4 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770423 8:11575047-11575069 GTGCCAGAGAGGCTGCTGGGGGG No data
1036770412_1036770420 1 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770420 8:11575044-11575066 CCTGTGCCAGAGAGGCTGCTGGG No data
1036770412_1036770414 -7 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770412_1036770421 2 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770421 8:11575045-11575067 CTGTGCCAGAGAGGCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036770412 Original CRISPR ACAGGGACGATAAGCGGTGA TGG (reversed) Intergenic
No off target data available for this crispr