ID: 1036770414

View in Genome Browser
Species Human (GRCh38)
Location 8:11575036-11575058
Sequence TCCCTGTCCCTGTGCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036770405_1036770414 25 Left 1036770405 8:11574988-11575010 CCCTGTGCCCGCCGCGGAGCCCT No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770408_1036770414 17 Left 1036770408 8:11574996-11575018 CCGCCGCGGAGCCCTCAGAACAG No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770410_1036770414 6 Left 1036770410 8:11575007-11575029 CCCTCAGAACAGTCCATCACCGC No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770411_1036770414 5 Left 1036770411 8:11575008-11575030 CCTCAGAACAGTCCATCACCGCT No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770407_1036770414 18 Left 1036770407 8:11574995-11575017 CCCGCCGCGGAGCCCTCAGAACA No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770412_1036770414 -7 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770404_1036770414 29 Left 1036770404 8:11574984-11575006 CCTTCCCTGTGCCCGCCGCGGAG No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770409_1036770414 14 Left 1036770409 8:11574999-11575021 CCGCGGAGCCCTCAGAACAGTCC No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data
1036770406_1036770414 24 Left 1036770406 8:11574989-11575011 CCTGTGCCCGCCGCGGAGCCCTC No data
Right 1036770414 8:11575036-11575058 TCCCTGTCCCTGTGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036770414 Original CRISPR TCCCTGTCCCTGTGCCAGAG AGG Intergenic
No off target data available for this crispr