ID: 1036770422

View in Genome Browser
Species Human (GRCh38)
Location 8:11575046-11575068
Sequence TGTGCCAGAGAGGCTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036770411_1036770422 15 Left 1036770411 8:11575008-11575030 CCTCAGAACAGTCCATCACCGCT No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770408_1036770422 27 Left 1036770408 8:11574996-11575018 CCGCCGCGGAGCCCTCAGAACAG No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770410_1036770422 16 Left 1036770410 8:11575007-11575029 CCCTCAGAACAGTCCATCACCGC No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770409_1036770422 24 Left 1036770409 8:11574999-11575021 CCGCGGAGCCCTCAGAACAGTCC No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770407_1036770422 28 Left 1036770407 8:11574995-11575017 CCCGCCGCGGAGCCCTCAGAACA No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770413_1036770422 -3 Left 1036770413 8:11575026-11575048 CCGCTTATCGTCCCTGTCCCTGT No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data
1036770412_1036770422 3 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770422 8:11575046-11575068 TGTGCCAGAGAGGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036770422 Original CRISPR TGTGCCAGAGAGGCTGCTGG GGG Intergenic
No off target data available for this crispr