ID: 1036770425

View in Genome Browser
Species Human (GRCh38)
Location 8:11575053-11575075
Sequence GAGAGGCTGCTGGGGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036770415_1036770425 -7 Left 1036770415 8:11575037-11575059 CCCTGTCCCTGTGCCAGAGAGGC No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770413_1036770425 4 Left 1036770413 8:11575026-11575048 CCGCTTATCGTCCCTGTCCCTGT No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770410_1036770425 23 Left 1036770410 8:11575007-11575029 CCCTCAGAACAGTCCATCACCGC No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770411_1036770425 22 Left 1036770411 8:11575008-11575030 CCTCAGAACAGTCCATCACCGCT No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770412_1036770425 10 Left 1036770412 8:11575020-11575042 CCATCACCGCTTATCGTCCCTGT No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data
1036770416_1036770425 -8 Left 1036770416 8:11575038-11575060 CCTGTCCCTGTGCCAGAGAGGCT No data
Right 1036770425 8:11575053-11575075 GAGAGGCTGCTGGGGGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036770425 Original CRISPR GAGAGGCTGCTGGGGGGTCC AGG Intergenic
No off target data available for this crispr