ID: 1036778269

View in Genome Browser
Species Human (GRCh38)
Location 8:11628456-11628478
Sequence CAGTAGGGATGCAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036778258_1036778269 -2 Left 1036778258 8:11628435-11628457 CCGTAACCCAGGGCTCCGGGGCA No data
Right 1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG No data
1036778262_1036778269 -9 Left 1036778262 8:11628442-11628464 CCAGGGCTCCGGGGCAGTAGGGA No data
Right 1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG No data
1036778260_1036778269 -8 Left 1036778260 8:11628441-11628463 CCCAGGGCTCCGGGGCAGTAGGG No data
Right 1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036778269 Original CRISPR CAGTAGGGATGCAGGGAAGG GGG Intergenic
No off target data available for this crispr