ID: 1036779429

View in Genome Browser
Species Human (GRCh38)
Location 8:11635278-11635300
Sequence GCTCCATGCCTGGCACATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036779420_1036779429 6 Left 1036779420 8:11635249-11635271 CCTATACAACATTGCAACCCTGT No data
Right 1036779429 8:11635278-11635300 GCTCCATGCCTGGCACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036779429 Original CRISPR GCTCCATGCCTGGCACATTG GGG Intergenic
No off target data available for this crispr