ID: 1036780691

View in Genome Browser
Species Human (GRCh38)
Location 8:11644961-11644983
Sequence CCATGTTAGCATCTGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036780688_1036780691 4 Left 1036780688 8:11644934-11644956 CCTAAGAAAATCTTTGCACGTTT No data
Right 1036780691 8:11644961-11644983 CCATGTTAGCATCTGTTTCTGGG No data
1036780687_1036780691 5 Left 1036780687 8:11644933-11644955 CCCTAAGAAAATCTTTGCACGTT No data
Right 1036780691 8:11644961-11644983 CCATGTTAGCATCTGTTTCTGGG No data
1036780686_1036780691 6 Left 1036780686 8:11644932-11644954 CCCCTAAGAAAATCTTTGCACGT No data
Right 1036780691 8:11644961-11644983 CCATGTTAGCATCTGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036780691 Original CRISPR CCATGTTAGCATCTGTTTCT GGG Intergenic
No off target data available for this crispr