ID: 1036781374

View in Genome Browser
Species Human (GRCh38)
Location 8:11650198-11650220
Sequence GGTTACAGTGGAGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036781370_1036781374 -9 Left 1036781370 8:11650184-11650206 CCTGGGAGGCCGAGGGTTACAGT No data
Right 1036781374 8:11650198-11650220 GGTTACAGTGGAGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036781374 Original CRISPR GGTTACAGTGGAGGAAAAGC TGG Intergenic
No off target data available for this crispr