ID: 1036783662

View in Genome Browser
Species Human (GRCh38)
Location 8:11670595-11670617
Sequence CCTCCTTTGACCCTGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783662_1036783665 17 Left 1036783662 8:11670595-11670617 CCAAGGAGCAGGGTCAAAGGAGG No data
Right 1036783665 8:11670635-11670657 CTCCCCTCATACACACAAGGTGG No data
1036783662_1036783669 21 Left 1036783662 8:11670595-11670617 CCAAGGAGCAGGGTCAAAGGAGG No data
Right 1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG No data
1036783662_1036783670 22 Left 1036783662 8:11670595-11670617 CCAAGGAGCAGGGTCAAAGGAGG No data
Right 1036783670 8:11670640-11670662 CTCATACACACAAGGTGGATGGG No data
1036783662_1036783664 14 Left 1036783662 8:11670595-11670617 CCAAGGAGCAGGGTCAAAGGAGG No data
Right 1036783664 8:11670632-11670654 ATTCTCCCCTCATACACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036783662 Original CRISPR CCTCCTTTGACCCTGCTCCT TGG (reversed) Intergenic
No off target data available for this crispr