ID: 1036783669

View in Genome Browser
Species Human (GRCh38)
Location 8:11670639-11670661
Sequence CCTCATACACACAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783662_1036783669 21 Left 1036783662 8:11670595-11670617 CCAAGGAGCAGGGTCAAAGGAGG No data
Right 1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036783669 Original CRISPR CCTCATACACACAAGGTGGA TGG Intergenic
No off target data available for this crispr