ID: 1036783993

View in Genome Browser
Species Human (GRCh38)
Location 8:11673289-11673311
Sequence TATTGAGGCCAGCAATGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783993_1036784001 18 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784001 8:11673330-11673352 CAGATTCTTGTAGGCACATGTGG No data
1036783993_1036783997 9 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036783997 8:11673321-11673343 TGAGGTCCCCAGATTCTTGTAGG No data
1036783993_1036784004 25 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data
1036783993_1036784005 28 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784005 8:11673340-11673362 TAGGCACATGTGGAGGAGGGAGG No data
1036783993_1036783994 -9 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036783994 8:11673303-11673325 GCCTCAATAATAATGCCATGAGG No data
1036783993_1036784002 21 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784002 8:11673333-11673355 ATTCTTGTAGGCACATGTGGAGG No data
1036783993_1036784003 24 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784003 8:11673336-11673358 CTTGTAGGCACATGTGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036783993 Original CRISPR TATTGAGGCCAGCAATGTCC AGG (reversed) Intergenic
No off target data available for this crispr