ID: 1036783995

View in Genome Browser
Species Human (GRCh38)
Location 8:11673304-11673326
Sequence ACCTCATGGCATTATTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783995_1036783997 -6 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036783997 8:11673321-11673343 TGAGGTCCCCAGATTCTTGTAGG No data
1036783995_1036784005 13 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784005 8:11673340-11673362 TAGGCACATGTGGAGGAGGGAGG No data
1036783995_1036784004 10 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data
1036783995_1036784001 3 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784001 8:11673330-11673352 CAGATTCTTGTAGGCACATGTGG No data
1036783995_1036784003 9 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784003 8:11673336-11673358 CTTGTAGGCACATGTGGAGGAGG No data
1036783995_1036784007 20 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784007 8:11673347-11673369 ATGTGGAGGAGGGAGGCAGTGGG No data
1036783995_1036784008 30 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784008 8:11673357-11673379 GGGAGGCAGTGGGATGTCAGAGG No data
1036783995_1036784002 6 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784002 8:11673333-11673355 ATTCTTGTAGGCACATGTGGAGG No data
1036783995_1036784006 19 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784006 8:11673346-11673368 CATGTGGAGGAGGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036783995 Original CRISPR ACCTCATGGCATTATTATTG AGG (reversed) Intergenic
No off target data available for this crispr