ID: 1036783996

View in Genome Browser
Species Human (GRCh38)
Location 8:11673318-11673340
Sequence ACAAGAATCTGGGGACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783996_1036784004 -4 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data
1036783996_1036784003 -5 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784003 8:11673336-11673358 CTTGTAGGCACATGTGGAGGAGG No data
1036783996_1036784008 16 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784008 8:11673357-11673379 GGGAGGCAGTGGGATGTCAGAGG No data
1036783996_1036784005 -1 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784005 8:11673340-11673362 TAGGCACATGTGGAGGAGGGAGG No data
1036783996_1036784006 5 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784006 8:11673346-11673368 CATGTGGAGGAGGGAGGCAGTGG No data
1036783996_1036784009 22 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784009 8:11673363-11673385 CAGTGGGATGTCAGAGGTGAAGG No data
1036783996_1036784002 -8 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784002 8:11673333-11673355 ATTCTTGTAGGCACATGTGGAGG No data
1036783996_1036784007 6 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784007 8:11673347-11673369 ATGTGGAGGAGGGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036783996 Original CRISPR ACAAGAATCTGGGGACCTCA TGG (reversed) Intergenic
No off target data available for this crispr