ID: 1036784004

View in Genome Browser
Species Human (GRCh38)
Location 8:11673337-11673359
Sequence TTGTAGGCACATGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036783993_1036784004 25 Left 1036783993 8:11673289-11673311 CCTGGACATTGCTGGCCTCAATA No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data
1036783996_1036784004 -4 Left 1036783996 8:11673318-11673340 CCATGAGGTCCCCAGATTCTTGT No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data
1036783995_1036784004 10 Left 1036783995 8:11673304-11673326 CCTCAATAATAATGCCATGAGGT No data
Right 1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036784004 Original CRISPR TTGTAGGCACATGTGGAGGA GGG Intergenic
No off target data available for this crispr