ID: 1036786451

View in Genome Browser
Species Human (GRCh38)
Location 8:11691182-11691204
Sequence CTTGGATTGCAGATGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036786451_1036786454 2 Left 1036786451 8:11691182-11691204 CCAGTTTTCATCTGCAATCCAAG 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1036786454 8:11691207-11691229 TTTTATTTTGCATATTCAGATGG No data
1036786451_1036786455 3 Left 1036786451 8:11691182-11691204 CCAGTTTTCATCTGCAATCCAAG 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1036786455 8:11691208-11691230 TTTATTTTGCATATTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036786451 Original CRISPR CTTGGATTGCAGATGAAAAC TGG (reversed) Intronic
901562655 1:10085009-10085031 CTTGGATTCCAACTGGAAACTGG - Intronic
902795737 1:18799533-18799555 CTTGGATTGCAGATGGACTGAGG - Intergenic
905596113 1:39208889-39208911 CTGGGATTACAGGCGAAAACAGG + Intronic
907654402 1:56327500-56327522 ATGGGAATGGAGATGAAAACGGG + Intergenic
909250795 1:73353548-73353570 CTTGGAGTTCAGATTAGAACTGG - Intergenic
910061056 1:83092882-83092904 CTTGGATTGCATCCAAAAACAGG + Intergenic
911441922 1:97937835-97937857 CTGGGATTGCAAATAAACACTGG - Intergenic
912629280 1:111233214-111233236 CCGGGATTTCTGATGAAAACAGG - Intronic
913595116 1:120368035-120368057 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914092155 1:144510951-144510973 CTTGGATTCCTGAGGAAAATAGG + Intergenic
914306379 1:146422914-146422936 CTTGGATTCCTGAGGAAAATAGG - Intergenic
914595669 1:149149888-149149910 CTTGGATTCCTGAGGAAAATAGG + Intergenic
920764105 1:208815106-208815128 CATGGATTGAAGATGGAAAGTGG + Intergenic
921410142 1:214826971-214826993 ATTGCGTTGCAGAAGAAAACTGG - Intergenic
921912504 1:220565543-220565565 CTTGGATTGCCTATGAAGAGCGG + Intronic
1064042317 10:11978246-11978268 CTCAGAATGCAAATGAAAACGGG - Intronic
1069796554 10:71056449-71056471 CATGGATTTAAGATCAAAACAGG - Intergenic
1070422001 10:76246426-76246448 ATTAGAATGCAGAAGAAAACAGG - Intronic
1073305378 10:102499671-102499693 TCTGCATTGCTGATGAAAACAGG + Intronic
1073693158 10:105834238-105834260 CTTGCAGTTCAGATGAAAACTGG + Intergenic
1074703674 10:116113299-116113321 ACTGGATTGCAGGTGAAAAGAGG - Intronic
1074840789 10:117348871-117348893 CTTGTATTCCAGCAGAAAACAGG - Intronic
1075298154 10:121296321-121296343 TTAGGATTTCAGATGAAAATGGG - Intergenic
1078364460 11:10694517-10694539 TTTGGATTTCAGATAAACACAGG + Intergenic
1078639461 11:13081647-13081669 CTTGGAGGGCTGATGAAAGCTGG + Intergenic
1079042338 11:17070477-17070499 CTTGAATTGCTGATAAACACCGG - Intergenic
1081345072 11:41975543-41975565 ATTGGATAGCAGATGGGAACAGG - Intergenic
1082034283 11:47632316-47632338 CTGGGATTGCAAATGTAAGCAGG + Intronic
1082960796 11:58917017-58917039 ACTGCATTGCAGATGAAAAACGG - Intronic
1082961624 11:58923488-58923510 ACTGCATTGCAGATGAAAAAGGG - Intronic
1086232882 11:84591785-84591807 ATTTGATTGCGGATGCAAACTGG - Intronic
1086849662 11:91794394-91794416 ATTGGGCTGCAGATGAAAAATGG - Intergenic
1089897174 11:121942246-121942268 CTAAGATAGCAGATTAAAACAGG - Intergenic
1091953894 12:4619995-4620017 CATGGATAGGGGATGAAAACTGG + Intronic
1092615091 12:10209876-10209898 CTGGGATTACAGATGTAATCCGG - Intergenic
1093014185 12:14139589-14139611 CTTGCATTTCAGTTGAAGACAGG - Intergenic
1093838506 12:23866754-23866776 AGAGGATTGAAGATGAAAACTGG - Intronic
1095240452 12:39852728-39852750 TCTGCATTGCAGATGAAAAATGG + Intronic
1098015783 12:66103288-66103310 CTTGGAATCCAGATGAAGAGTGG + Intergenic
1100156980 12:91811260-91811282 ATTGGAGTGCAGATGACAAGAGG - Intergenic
1101889048 12:108695422-108695444 CTTGGATAGAGGATGCAAACTGG - Intronic
1102658309 12:114502441-114502463 CTTGGCTAGCAGATGAAAGGTGG - Intergenic
1105245792 13:18648952-18648974 CTTGGATTTCAAATCACAACTGG - Intergenic
1107283613 13:38764883-38764905 CTTGAATTGGAGTTGAAAAAAGG - Intronic
1108454217 13:50597047-50597069 ATTGGATTGCAGATTAAATCAGG + Intronic
1109273419 13:60279260-60279282 GTTGTATTGCAGATAAAAACGGG + Intergenic
1109406913 13:61912398-61912420 CTTGGTTTGCAGATCACAAAAGG - Intergenic
1110682589 13:78334143-78334165 CCTTGAGTGCAGATGAAATCAGG - Intergenic
1111705486 13:91743724-91743746 TTTGGACTGAAGATGAAAAAGGG - Intronic
1111830518 13:93323512-93323534 CTTGGAAGACAGGTGAAAACTGG - Intronic
1111876233 13:93899746-93899768 AATTGATGGCAGATGAAAACTGG - Intronic
1111974076 13:94947016-94947038 CTTGGATTGGAGGTGAAATGGGG + Intergenic
1114211372 14:20617921-20617943 CTTGGATAGTACATGTAAACAGG - Intergenic
1116241045 14:42343319-42343341 ATTGGAATGCAGATCAAAATAGG + Intergenic
1117896228 14:60490147-60490169 CATGGAGTACAGATGAAAAAAGG - Intronic
1124671543 15:31645426-31645448 CCTGGATAGTAGATGCAAACAGG - Intronic
1124797035 15:32791864-32791886 ATTGAATTGCAGATGAAGGCTGG + Intronic
1126148084 15:45496277-45496299 GATGGAATGCAGATAAAAACGGG + Intronic
1127816920 15:62619170-62619192 CTTGGATTGGAGGTGAAAGGAGG + Intronic
1127900531 15:63337843-63337865 CTGGGATTGCAGGTGAGAACGGG + Intronic
1129709746 15:77814721-77814743 CTTGGATGCCAGATGGAAATGGG - Intronic
1131995694 15:98130896-98130918 CTGGGATAGCAGATGAGTACAGG - Intergenic
1135533757 16:23276774-23276796 CTGGGATTACAGATGTAAGCTGG + Intergenic
1135601144 16:23784651-23784673 TTTAGATTGCAGTGGAAAACTGG + Intergenic
1139635464 16:68255754-68255776 TCTGGCCTGCAGATGAAAACGGG + Exonic
1140246072 16:73250966-73250988 CTCAGATTGCAGATGAGACCAGG - Intergenic
1141107486 16:81245426-81245448 TTTGGTTTGCAGGTGGAAACGGG + Intronic
1141842608 16:86583791-86583813 CTTGGGGTGCAAATGAAATCTGG + Intergenic
1142889982 17:2936982-2937004 CTGGGATTACAGATGAAATGGGG + Intronic
1144425002 17:15133420-15133442 ACTGCATTGCAGATGAAAAATGG - Intergenic
1145230732 17:21171628-21171650 CAGGGATTGAAAATGAAAACAGG + Intronic
1145779141 17:27550520-27550542 GTTGGGCTGCAGATGAACACAGG + Intronic
1147418180 17:40308649-40308671 CTTAGATGGCAGCTGGAAACAGG - Intergenic
1149730082 17:58936901-58936923 ATTGGATTGAATATGAAAGCTGG - Intronic
1149957788 17:61072322-61072344 GTAGAATTACAGATGAAAACAGG - Intronic
1150476594 17:65480296-65480318 CTGGGATAGCAGATGAGAATGGG + Intergenic
1151090922 17:71439502-71439524 CATGGTCTGGAGATGAAAACTGG - Intergenic
1151397600 17:73834323-73834345 CTGTGATTGCCCATGAAAACAGG + Intergenic
1151893018 17:76962339-76962361 CTTCGATTTGAAATGAAAACTGG + Intergenic
1152531151 17:80920002-80920024 CTGGGTTTGGAGATGCAAACTGG - Intronic
1153315128 18:3713894-3713916 GTTGGATTACATAGGAAAACAGG + Intronic
1157317896 18:46608671-46608693 CTTGGATTGGAGAAGAAATAGGG - Intronic
1157362526 18:47032972-47032994 CTTGCCTTGCAGATAAAATCTGG - Exonic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1159641925 18:70873449-70873471 TTTGGATTGCAGTTGACCACAGG + Intergenic
1160200741 18:76793124-76793146 CTTGGGCTCCAGATGAAGACTGG + Intergenic
1161396100 19:4045710-4045732 CTAGCATTGCATATGCAAACGGG + Exonic
1165197662 19:34117606-34117628 CTTGGATTTATGATGAAAATGGG + Intergenic
924972300 2:139896-139918 TTAGGCTGGCAGATGAAAACCGG + Intergenic
925560771 2:5192262-5192284 TTTGGATTGCCGATGAAAGGAGG + Intergenic
925603802 2:5637378-5637400 CTTGGATTACTGAGGAAAATAGG - Intergenic
925696568 2:6586235-6586257 CTTGGATGTGAGGTGAAAACAGG + Intergenic
925888462 2:8413424-8413446 CTCAGTTTGCAGTTGAAAACTGG + Intergenic
926414853 2:12639564-12639586 CTTGGATTGCAGAATAAAGATGG - Intergenic
926692722 2:15748302-15748324 CATGCATTGCAGATGAGACCTGG + Intergenic
926738005 2:16088990-16089012 CTTGGACTGCAGCGGAAAACTGG + Intergenic
927363617 2:22267536-22267558 CTGGTATGGCTGATGAAAACAGG + Intergenic
928342828 2:30460255-30460277 CAGAGATTGCAGATGAACACTGG - Intronic
930034703 2:47078191-47078213 CTTGGAATGAAGATGACAATGGG + Intronic
932430503 2:71671340-71671362 CTTGGCTTTCTGATGGAAACAGG - Intronic
933467524 2:82673599-82673621 TTTGGATAGCAAATGAAAACTGG - Intergenic
933957026 2:87379761-87379783 CTTGGATTGGGGGAGAAAACAGG + Intergenic
934241146 2:90271650-90271672 CTTGGATTGGGGGAGAAAACAGG + Intergenic
935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG + Intergenic
936008315 2:108909167-108909189 CTTGAGTTGCAGTTGAAGACAGG - Intronic
936534565 2:113302088-113302110 CTTGGGTTCCACATGAACACAGG - Intergenic
937627312 2:124057670-124057692 ATTGGATTGCAGCTCAAAAAAGG - Intronic
938552214 2:132392840-132392862 CTGGGATGGCAGAAGAAAAGAGG + Intergenic
942459252 2:176158323-176158345 CTTGGAGTGCCGGTGAAAAAAGG - Intronic
943649767 2:190444502-190444524 GGTGGATTGCAGATGTAAAGTGG + Intronic
946427603 2:219607852-219607874 CTTGGATTGCATGTGACCACAGG + Intronic
1169040729 20:2493259-2493281 CTTGGATTACAGAGAAAAATGGG + Intronic
1172044309 20:32069239-32069261 CTTGGATTGTGAATGAACACAGG + Intronic
1173652928 20:44678760-44678782 GCTGGATTGTAGATGCAAACAGG + Intergenic
1177874839 21:26619438-26619460 CCTGGATTGCAGATGAAAGAGGG - Intergenic
1180203133 21:46239226-46239248 CTTTGATTGCAGGTGAAAGAGGG + Intronic
1182248771 22:28982941-28982963 CTTGCACTGGAGATGTAAACTGG + Intronic
949094800 3:73513-73535 TTTGAATTGCAAATGAAACCTGG - Intergenic
953760086 3:45679778-45679800 CTTGTATTGCAGATCAAACTGGG - Exonic
953915800 3:46920523-46920545 CTGGGATTGCAGCTGGAAACAGG - Intergenic
958730852 3:97958786-97958808 CTTGAACTGTACATGAAAACAGG + Intronic
959033047 3:101324990-101325012 CTGGCTTTGCAGATGAATACTGG + Exonic
959789613 3:110343569-110343591 CTTGGGTAGCGGAAGAAAACAGG - Intergenic
961373252 3:126445517-126445539 CTTGGAGTGCACACAAAAACAGG - Intronic
963175815 3:142296845-142296867 CTTGGTTTGAAAATGAAAACTGG - Intergenic
963486474 3:145940133-145940155 CTGGTATTGCAGATGATGACAGG + Intergenic
964207866 3:154194787-154194809 CTTGGCTTGATGCTGAAAACTGG + Intronic
964261497 3:154843406-154843428 CTTGAGTTTCAGATGAAAATAGG + Intergenic
967940576 3:194763207-194763229 ATTTGAATGCATATGAAAACAGG + Intergenic
967962259 3:194935177-194935199 GTTGGGTTGGAGATGAAATCAGG + Intergenic
969667579 4:8569930-8569952 CTTAGATTACTTATGAAAACTGG + Intronic
969943445 4:10758575-10758597 CTTGTTTTACAGATGAAATCAGG + Intergenic
970176230 4:13342044-13342066 ATTGTATTACAGTTGAAAACGGG - Intergenic
977126560 4:93175854-93175876 GTTGGATTGGAGGGGAAAACTGG - Intronic
977877621 4:102167326-102167348 CTAGGATGACATATGAAAACTGG + Intergenic
980390866 4:132144677-132144699 ATTGGATAGCAAAGGAAAACTGG + Intergenic
981079472 4:140624359-140624381 ATTGGATAGCAGAAGCAAACAGG - Exonic
983259744 4:165442980-165443002 CTGGGATTGCAGTGAAAAACAGG - Intronic
983378147 4:166956611-166956633 TTTGGAATGCAGTTGAAAATGGG + Intronic
984382134 4:179008034-179008056 CTAGGAGTGCAGAAGAAAGCTGG + Intergenic
986381604 5:7192142-7192164 CGTGGATTTCTTATGAAAACTGG - Intergenic
987757568 5:22116258-22116280 GTTGGCTTGCAGATGAAAGGGGG + Intronic
988779073 5:34502806-34502828 CATGGATTCTAGAAGAAAACTGG + Intergenic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
991534065 5:67647296-67647318 CTTGGATTCAGGATGAAAAAAGG - Intergenic
994403000 5:99305998-99306020 TTTGGATTGAGGATGAAAAATGG + Intergenic
995172796 5:109137248-109137270 CTTGGTTTCCAGAAGAAAAAAGG + Intronic
995365872 5:111359779-111359801 CTGGGAGTGAAGATTAAAACTGG - Intronic
1001370312 5:171193419-171193441 GTTGTATTTCAGATGAAAATGGG + Intronic
1001815447 5:174665056-174665078 CTTGGATTGCCGGTCCAAACTGG + Intergenic
1002787979 6:418959-418981 CTTGGGTTGGGGATGAGAACGGG - Intergenic
1004105742 6:12666099-12666121 CTTGGAGAGGAGAAGAAAACAGG + Intergenic
1005199702 6:23330123-23330145 CTTGGAATGAAGATGACAACTGG + Intergenic
1007281201 6:40713699-40713721 CATGGGTTGCAAATGTAAACAGG - Intergenic
1007302911 6:40881894-40881916 CTTGCATGGTAGCTGAAAACAGG - Intergenic
1009289105 6:61862204-61862226 CTTTGCTTGCAGATGACAATAGG - Intronic
1010405924 6:75505723-75505745 ACTGCATTGCAGATGAAAAATGG - Intergenic
1011874877 6:91946169-91946191 CTTTGATTGCAGAAGACAAATGG + Intergenic
1012188073 6:96246687-96246709 TTTGGATTGCAGTTGACCACGGG + Intergenic
1015387775 6:132645285-132645307 ATTGGATTGGAAATGAAAAATGG - Exonic
1015615235 6:135067527-135067549 CTGAGATTCCAGATGACAACCGG + Intronic
1016324076 6:142879840-142879862 CTGGGATTGCAGTTTAAACCAGG - Intronic
1017032990 6:150240662-150240684 TCTGCATTGCAGATGAAAAATGG - Intronic
1018975216 6:168559652-168559674 CTTGGCTGGCAGATGAGCACAGG - Intronic
1020114960 7:5471078-5471100 CTTGCTTTGCAGATGAAGTCGGG - Intronic
1022987196 7:35667435-35667457 CTTGCATTACATATGGAAACTGG + Exonic
1024463806 7:49686898-49686920 CTTGGATTCTAGATCAAAACTGG - Intergenic
1024781395 7:52854572-52854594 CTTGCATTTGAGCTGAAAACTGG - Intergenic
1026394880 7:69941312-69941334 CTTGGATTCAAGAGGAAAAGGGG + Intronic
1030113866 7:106048788-106048810 CTTGTTATGCAGATGAAAAAAGG + Intergenic
1030765438 7:113403666-113403688 CTTGGTTTGCAGATGAAGTCAGG + Intergenic
1035435149 7:158854058-158854080 GTAGGATTGGAGATGAAATCAGG + Intergenic
1036026239 8:4912437-4912459 CAAGGATTGAAGGTGAAAACGGG + Intronic
1036532522 8:9607431-9607453 CTTTGATTCCACATGCAAACTGG + Intronic
1036786451 8:11691182-11691204 CTTGGATTGCAGATGAAAACTGG - Intronic
1038923855 8:32115970-32115992 CTTATATTACAGATGAAAAGAGG - Intronic
1039261502 8:35776838-35776860 CTTGGATTACAGATGTGAGCCGG - Intronic
1043499945 8:80842978-80843000 CTTGAGTTGAAGATGAAAGCAGG - Intronic
1043802265 8:84624451-84624473 CTGGCATTGAAGATGAAAAAGGG - Intronic
1050613775 9:7380741-7380763 CTTGGACTGCAGTTGATCACAGG - Intergenic
1051134395 9:13901946-13901968 TTTGGACTGCAGTTGAACACAGG - Intergenic
1055551207 9:77433629-77433651 CTGGGATTACAGATGTGAACAGG + Intronic
1058817272 9:108695871-108695893 CTTGTAATGCAGATACAAACAGG - Intergenic
1059222717 9:112640273-112640295 CCTGGATTTCAAATGAAAGCTGG + Intronic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1060431638 9:123555853-123555875 TTTGGATTCCAGATGCACACAGG + Intronic
1061702462 9:132426392-132426414 CTTGGGTTGCAGGTGGAAACGGG - Intronic
1186952123 X:14638086-14638108 CCTGCATTTCAGATGAAAAAGGG + Intronic
1188763803 X:34065223-34065245 CTTGGTTTCCAGATTCAAACTGG + Intergenic
1189106425 X:38240267-38240289 CTTGGCTAGGAGATGAAAACTGG + Intronic
1192033414 X:67539230-67539252 ACTGGATTGGAGATGAAAAGAGG - Intergenic
1194973330 X:100368269-100368291 CTTGGATAGCCTCTGAAAACTGG + Intronic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1198761956 X:140041605-140041627 CATGGAATACAGTTGAAAACAGG - Intergenic
1199187663 X:144936196-144936218 CTTGGATTTCATATGAAAATGGG - Intergenic
1201735679 Y:17258135-17258157 ATTGGAAAGCAGATGAAAAATGG - Intergenic
1201849185 Y:18458879-18458901 CTAGGATTATAGTTGAAAACTGG - Intergenic
1201884133 Y:18861496-18861518 CTAGGATTATAGTTGAAAACTGG + Intergenic