ID: 1036787999

View in Genome Browser
Species Human (GRCh38)
Location 8:11700711-11700733
Sequence CGGCCCTGCCGCGAGGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036787999_1036788005 2 Left 1036787999 8:11700711-11700733 CCGGATCCCTCGCGGCAGGGCCG 0: 1
1: 0
2: 2
3: 5
4: 84
Right 1036788005 8:11700736-11700758 GAGGCGCGTCCATATCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1036787999_1036788007 23 Left 1036787999 8:11700711-11700733 CCGGATCCCTCGCGGCAGGGCCG 0: 1
1: 0
2: 2
3: 5
4: 84
Right 1036788007 8:11700757-11700779 GGAATTCGTTCCATAGAATGAGG 0: 1
1: 0
2: 1
3: 4
4: 67
1036787999_1036788004 -1 Left 1036787999 8:11700711-11700733 CCGGATCCCTCGCGGCAGGGCCG 0: 1
1: 0
2: 2
3: 5
4: 84
Right 1036788004 8:11700733-11700755 GCAGAGGCGCGTCCATATCTTGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036787999 Original CRISPR CGGCCCTGCCGCGAGGGATC CGG (reversed) Intronic
900473040 1:2863865-2863887 CGGCCCTGCCCGGAGGGAGTTGG - Intergenic
901631461 1:10650083-10650105 GGGCCCTGCGGCGAGAGGTCCGG + Intronic
902538625 1:17136610-17136632 GGGCCCTGAAGCAAGGGATCTGG + Intergenic
902813834 1:18904797-18904819 GGGCCCTGGGGGGAGGGATCAGG - Exonic
904673015 1:32180040-32180062 CCGGCCTGCCGCGAGGGGGCCGG + Intronic
905631863 1:39523158-39523180 AGGCCCTGCAGAGAGGGGTCTGG + Intronic
906202673 1:43970207-43970229 CGGCGCTGCAGCGAGAGACCGGG + Exonic
916651682 1:166839648-166839670 CGGCCCAGCCGCCCGGGACCCGG - Intronic
922725076 1:227918857-227918879 AGGCCCTGCCTTGAGGGACCTGG - Exonic
1065180661 10:23121427-23121449 GGGCCCTGCCGGGAGGTAACTGG - Exonic
1067234993 10:44439687-44439709 GAGCCCTGCCGCGAGGGGTATGG + Intergenic
1073155356 10:101342089-101342111 CAGCCCAGCAGGGAGGGATCTGG - Intergenic
1077446271 11:2592454-2592476 GGGCCCTGCTGCGTGGGATGAGG - Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1083163927 11:60872015-60872037 CCGCCCTGCCGTGAGGGTTGGGG + Intronic
1083842783 11:65314522-65314544 CAGCCCTGCAGGGAAGGATCCGG + Intergenic
1084892570 11:72243864-72243886 CGGCCCTGCCGCGGGGAAAGCGG + Exonic
1090125009 11:124075942-124075964 AGGCCCTCCCGCGAAGGCTCAGG - Intergenic
1090709801 11:129374559-129374581 CGGTCGTATCGCGAGGGATCCGG + Intergenic
1098369321 12:69739500-69739522 CAGCCCTGCCGCGCGGCGTCCGG - Exonic
1103932910 12:124460037-124460059 CCGCCCTGCTGCGGGGGGTCAGG - Intronic
1104013442 12:124947779-124947801 CGGCCCTGCAGCCAGGTTTCTGG + Exonic
1107791281 13:44004814-44004836 CTGCCCTACCACCAGGGATCAGG - Intergenic
1110426484 13:75373113-75373135 CGGCTCAGCCCAGAGGGATCTGG + Intronic
1113936182 13:113996265-113996287 AGGCCCTGCCCCGGGGGAGCGGG - Intronic
1114912677 14:27220261-27220283 CTGCCCTGCAGGTAGGGATCAGG + Intergenic
1119325760 14:73758994-73759016 CGGCGCTGCCGCCAGGCACCAGG + Intronic
1119821121 14:77616794-77616816 GGGACCTGCCGAGAGGGATGTGG + Intergenic
1129193578 15:73951724-73951746 CTGCCCTGCCACGAGGGATCTGG + Intronic
1129455202 15:75673101-75673123 CTGCCCTGCCCCCAGGGAGCTGG - Intergenic
1132954677 16:2585423-2585445 CGGCCCTGCAGGGAGGGAGGAGG - Intronic
1141572285 16:84941305-84941327 CGGCCCTGCAGAGAGGGAATTGG - Intergenic
1143297996 17:5885613-5885635 GGGCCATGCAGGGAGGGATCAGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1154379614 18:13837478-13837500 AGCCCCTGCCGCGAGGGACCTGG + Intergenic
1154991240 18:21600285-21600307 CAGCACTGCCGCGAGGGCTCCGG - Intronic
1159914583 18:74177042-74177064 CGGCCGTGCAGCGGGGGCTCTGG - Intergenic
1160991864 19:1863391-1863413 CGGCCCGGCCCCGAGGGCGCGGG - Exonic
1162112160 19:8405101-8405123 CTGCCCTGCCTGGAGGGATAGGG + Intronic
1162668696 19:12237219-12237241 CTGCGCTGCCGAGAGGGCTCCGG + Intronic
1163121433 19:15220568-15220590 CGACCCCGCAGGGAGGGATCCGG - Intergenic
1165735677 19:38173977-38173999 GGGCCCTGTCGGGAGGGCTCTGG + Intronic
1166367898 19:42286487-42286509 CAGCCCTGCCACCAGGGACCAGG - Intronic
1168271867 19:55254529-55254551 CAGCTCTGCCGCCAGGGAACCGG + Intronic
1202715314 1_KI270714v1_random:39055-39077 CAGCCCTGCCGTGATGGAACCGG - Intergenic
925305831 2:2847464-2847486 TGGCCCTGCAGGGAGGGAGCTGG - Intergenic
925610453 2:5697035-5697057 CGGGCCTGCCGCGAGGGCTCGGG - Exonic
928108627 2:28489108-28489130 TGGCCCTGCCACGTGGGACCAGG + Intronic
930107272 2:47650181-47650203 CGGCCCTGTCGCTAGGAAACAGG - Intergenic
937366073 2:121262579-121262601 CTCCCCTGCAGCGTGGGATCCGG + Intronic
946248118 2:218398605-218398627 AGGCCCTGCCGAGGGGGAGCCGG - Intronic
946306582 2:218859908-218859930 CGGCCGGGAGGCGAGGGATCCGG - Exonic
948878177 2:240841256-240841278 CGGCCCTTCCCTGATGGATCTGG + Intergenic
1170793336 20:19525741-19525763 CGGCCCAGCTGGGTGGGATCTGG - Intronic
1171385983 20:24769840-24769862 CGGACCTGCCCCCAGGGAGCAGG + Intergenic
1178992521 21:37367364-37367386 CGGCCCCGCCGCCTGGAATCGGG + Intronic
1179833352 21:44012207-44012229 CGGGCCGGCCGCGCGGGACCGGG - Intergenic
1180057177 21:45365027-45365049 CGGCCCTGCCGTGAGGATGCTGG - Intergenic
1181006724 22:20016991-20017013 CGGCCCCTCCGCGAGGGGGCCGG - Intergenic
949918895 3:8986027-8986049 CATCCCTGCCGCGAGGCTTCTGG - Intronic
954110146 3:48429165-48429187 CGCCCCTGCCCGGCGGGATCGGG + Intronic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
961467101 3:127088703-127088725 CGGGCCTACCGCCAGGGCTCGGG - Intergenic
966875645 3:184320261-184320283 GGGCCCTGCCCCCAGAGATCAGG + Intronic
967858300 3:194134407-194134429 CGGCCCGGCCGCCCGGGACCCGG + Intergenic
968510541 4:993622-993644 CGGCCCTGCCGGGGGGGCTTAGG + Intronic
968921723 4:3525694-3525716 CTGCCCTGCGGAGAGGGATGAGG - Intronic
969444918 4:7239284-7239306 GGGCCCAGCACCGAGGGATCTGG + Intronic
969613272 4:8238571-8238593 CAGGCCTGCCGCGGGGGATACGG - Intronic
980930139 4:139177001-139177023 CGGCCCTGCTGAGAGGGAAAAGG - Exonic
982468422 4:155759191-155759213 CGGCCTGGCAGCGAGGGAACTGG + Intronic
985499518 5:233571-233593 CGCCCCTGTCGCGAAGGACCTGG + Exonic
985781978 5:1876375-1876397 AGGCCCTGTCGCCAGGGTTCAGG + Intergenic
990130854 5:52581195-52581217 AGGCCCTGCAGCTGGGGATCTGG + Intergenic
992105849 5:73448432-73448454 CGGGCCTGCCGCCCGGGACCCGG - Intergenic
992286022 5:75236536-75236558 CCGCCCTGGCGCGAGGGTTCAGG + Intronic
997582887 5:135028349-135028371 CGTCCCCGCCGCGCTGGATCCGG - Exonic
999461201 5:151758721-151758743 CGGCGCGGCCGGCAGGGATCAGG - Exonic
1003653066 6:7979106-7979128 CAGTCCTGCCTCGTGGGATCAGG - Intronic
1015843857 6:137497812-137497834 CGCCCCAGCCGCGAGGGCGCGGG - Intergenic
1019476455 7:1246890-1246912 CGGCCCGGCTGCCAGGGCTCCGG - Intergenic
1023842520 7:44105108-44105130 CGGCCCTGCCGCCCGGGTGCTGG - Intronic
1023912439 7:44565561-44565583 CAGCCCTGCTGCCTGGGATCAGG - Exonic
1035401670 7:158569997-158570019 CGGCCTTGGCGCGTGGGCTCTGG - Intronic
1036787999 8:11700711-11700733 CGGCCCTGCCGCGAGGGATCCGG - Intronic
1040065294 8:43140289-43140311 AGGCCCTGCCTTGAGGGAGCTGG - Intergenic
1061862553 9:133475492-133475514 CGTCCCTGCCCCGAGAGAGCAGG + Exonic
1185464599 X:346894-346916 CGGCCCTCCCGTGAGGGATGAGG + Intronic
1185464609 X:346933-346955 CGGCCCTCCCGTGAGGGATGAGG + Intronic
1189349697 X:40267286-40267308 AGGCCTGCCCGCGAGGGATCCGG - Intergenic
1200123372 X:153801779-153801801 AGGCCCTGCTGGGAGGGATGGGG + Intergenic
1200147549 X:153934564-153934586 CTGCCCAGCCCCGAGGGAGCGGG - Intronic