ID: 1036793276

View in Genome Browser
Species Human (GRCh38)
Location 8:11737572-11737594
Sequence CAGCATTAGAAGCCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036793270_1036793276 9 Left 1036793270 8:11737540-11737562 CCTAATAAATAAAAGAAACCAGG 0: 1
1: 0
2: 2
3: 62
4: 723
Right 1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG No data
1036793269_1036793276 22 Left 1036793269 8:11737527-11737549 CCATTGCAATCTTCCTAATAAAT 0: 1
1: 0
2: 3
3: 24
4: 318
Right 1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG No data
1036793272_1036793276 -9 Left 1036793272 8:11737558-11737580 CCAGGACCATATCACAGCATTAG 0: 1
1: 0
2: 1
3: 7
4: 69
Right 1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG No data
1036793268_1036793276 30 Left 1036793268 8:11737519-11737541 CCAAAGCTCCATTGCAATCTTCC 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1036793276 8:11737572-11737594 CAGCATTAGAAGCCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036793276 Original CRISPR CAGCATTAGAAGCCAGGCCA GGG Intronic
No off target data available for this crispr