ID: 1036802567

View in Genome Browser
Species Human (GRCh38)
Location 8:11803079-11803101
Sequence TTCCCCCTGTAGGGCCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036802553_1036802567 15 Left 1036802553 8:11803041-11803063 CCGACGCCTGGGTGTTCCCGTCC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802555_1036802567 -1 Left 1036802555 8:11803057-11803079 CCCGTCCCCCTTTCCTCGAGCCT 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802557_1036802567 -6 Left 1036802557 8:11803062-11803084 CCCCCTTTCCTCGAGCCTTCCCC 0: 1
1: 0
2: 2
3: 28
4: 509
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802554_1036802567 9 Left 1036802554 8:11803047-11803069 CCTGGGTGTTCCCGTCCCCCTTT 0: 1
1: 0
2: 2
3: 12
4: 122
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802556_1036802567 -2 Left 1036802556 8:11803058-11803080 CCGTCCCCCTTTCCTCGAGCCTT 0: 1
1: 0
2: 0
3: 41
4: 432
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802558_1036802567 -7 Left 1036802558 8:11803063-11803085 CCCCTTTCCTCGAGCCTTCCCCC 0: 1
1: 0
2: 0
3: 24
4: 357
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802560_1036802567 -9 Left 1036802560 8:11803065-11803087 CCTTTCCTCGAGCCTTCCCCCTG 0: 1
1: 0
2: 1
3: 17
4: 301
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802559_1036802567 -8 Left 1036802559 8:11803064-11803086 CCCTTTCCTCGAGCCTTCCCCCT 0: 1
1: 0
2: 0
3: 27
4: 325
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036802567 Original CRISPR TTCCCCCTGTAGGGCCCGGG TGG Intronic
900569468 1:3351246-3351268 TTCCACCTGGAGGGACCGGGAGG - Intronic
915105606 1:153533528-153533550 TTCTCCCTGCAGGGCAGGGGAGG + Intergenic
915883696 1:159700951-159700973 TACCCCCTGTAGGGCCGATGTGG + Intergenic
915974869 1:160378736-160378758 TTCACCCTGTTGGGCCAGGCTGG + Intergenic
1074722244 10:116273023-116273045 TCCCAACTTTAGGGCCCGGGGGG - Intronic
1077065036 11:637290-637312 TTCCCCATGGCGCGCCCGGGCGG - Exonic
1077233747 11:1470148-1470170 GTGCCCCTGTCCGGCCCGGGGGG + Exonic
1077269426 11:1668247-1668269 TTCCTTCCATAGGGCCCGGGTGG + Intergenic
1077455071 11:2673548-2673570 TTCCACCTGCATGGCCAGGGAGG - Intronic
1077484517 11:2832669-2832691 TTCCCTCTGTAGCTCCCGGTAGG + Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1080586011 11:33683183-33683205 TTGCTCCTGCAGGGCCTGGGAGG - Intergenic
1084310371 11:68312995-68313017 GTCCCCGGGGAGGGCCCGGGTGG - Intronic
1092171606 12:6376771-6376793 TGCCTCCTGTGGGGCCCGTGAGG - Intronic
1096181924 12:49555882-49555904 TAGCCCCTCTAGGGCCCGTGGGG - Exonic
1103912412 12:124359766-124359788 TTCCTCCAGTTGGGCCCAGGGGG + Intronic
1104439806 12:128785517-128785539 TTCCCCCTGCAGGTTCCAGGGGG + Intergenic
1105818414 13:24057804-24057826 TTCCCCTTGGAGGTCCAGGGAGG + Intronic
1106081946 13:26507604-26507626 ATCCCCTTGTAGGGCCCTGCTGG - Intergenic
1107831024 13:44373908-44373930 TGCCACCTGCAGCGCCCGGGTGG + Exonic
1107946831 13:45426454-45426476 TTTACTCTTTAGGGCCCGGGAGG - Intergenic
1113948723 13:114059461-114059483 TTCCCCCGGCAAGGCCCGTGTGG - Intronic
1118705310 14:68474892-68474914 TTCCTCCTGTAGTGCCGAGGAGG + Intronic
1119733183 14:76964170-76964192 TTCCTCCTGTAGGGAACAGGGGG - Intergenic
1121522859 14:94598339-94598361 TTCCCCCTGCATGGCCCAAGAGG - Intronic
1122228463 14:100293072-100293094 TTCCGCGTGGAGGGCCCGGGAGG - Intronic
1122230758 14:100305532-100305554 TGTCCCCGGGAGGGCCCGGGCGG - Intronic
1123020489 14:105395711-105395733 TACCCCGTGCAGGGCCTGGGAGG + Exonic
1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130468533 15:84204802-84204824 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130486153 15:84399383-84399405 ATCCCTCTGTGCGGCCCGGGCGG + Intergenic
1130495731 15:84468740-84468762 GGCCCCCTGCAGGGCCCGGTGGG - Intergenic
1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1131188538 15:90294812-90294834 GGCCCCCTGCAGGGCCCGGTGGG - Intronic
1136344625 16:29666761-29666783 CTTCCCCTGTGGGGCCTGGGTGG + Exonic
1138969623 16:62129222-62129244 GTCCCCCTGAAGTGCCTGGGAGG - Intergenic
1142180097 16:88664041-88664063 TACCCCCTGTAAGGCCCTGTAGG + Intergenic
1142216775 16:88833975-88833997 TTCCCCATGGGGAGCCCGGGGGG - Intronic
1142387430 16:89774765-89774787 TTCCACCTGCAGGGCCAGGGAGG - Intronic
1143222793 17:5276562-5276584 TTCCTTCTGTAGGTCCCAGGAGG + Intergenic
1144778291 17:17795726-17795748 TGCCCACTGTAGGGCCCAGCAGG - Exonic
1146289425 17:31597154-31597176 TTCCCCCTGCAGGGTCAGGGAGG - Intergenic
1147382397 17:40063348-40063370 CTCCCCCTGGAGGGCCCGCCCGG + Intronic
1147605843 17:41773304-41773326 ATCCTCCTGGAGGGCCAGGGCGG - Intronic
1152540433 17:80971859-80971881 TCCTCCCTGGAGGGCCCTGGGGG - Intergenic
1152727940 17:81956822-81956844 TTGCCCCAGAAGGGCCTGGGTGG - Intronic
1154028047 18:10725801-10725823 TCCACCCTGGAGGGCCCGCGTGG - Intronic
1156905657 18:42349002-42349024 TACCCCCTGTGGGGCCTTGGGGG + Intergenic
1159088923 18:63824642-63824664 TTCCCCATGTTGGGCCAGGCTGG - Intergenic
1160840251 19:1143572-1143594 TTTCCCCTGGAGCCCCCGGGAGG - Intronic
1161211507 19:3068349-3068371 CTCCCTCTGCTGGGCCCGGGTGG + Intergenic
1162034336 19:7931306-7931328 TGCCACCTGTGGGGCGCGGGTGG + Intronic
930688102 2:54330663-54330685 TTCCCATTGTAGGGCCAGGAGGG - Intronic
940751048 2:157628194-157628216 TTCACCCTGCAGGGACCTGGAGG - Intronic
942737506 2:179132331-179132353 TTTCTGCTGTAGGGCCTGGGAGG + Exonic
942856440 2:180555317-180555339 TTCCCCCTGTGGCTCCCAGGTGG - Intergenic
1169006019 20:2207667-2207689 CTCTCCCTGCAAGGCCCGGGCGG + Intergenic
1171384841 20:24763180-24763202 TTCCCTCTGGATGGCCAGGGGGG + Intergenic
1176161579 20:63651438-63651460 TGACCCCTGGAGGGCCCTGGAGG + Intronic
1178225776 21:30716582-30716604 TTCCCCATGTTTGGCCAGGGTGG - Intergenic
1179190584 21:39118892-39118914 TTCCCTGGGTAGGGCCGGGGAGG - Intergenic
1180725209 22:17941873-17941895 TTCCCCCTCCTGGGCCCTGGAGG - Intronic
1181388174 22:22559347-22559369 ATCCCCCTAGAGGGCCTGGGAGG - Exonic
1181473695 22:23156081-23156103 TTCCCACTGTGGAGCCCGGCAGG - Intronic
1181644993 22:24226240-24226262 CTCCCCCAGCAGGTCCCGGGAGG + Exonic
1181830342 22:25555477-25555499 TGGCCCCTGGAGGGCCTGGGAGG + Intergenic
1183406693 22:37633694-37633716 TTTCCGGTGCAGGGCCCGGGGGG - Intergenic
1183949326 22:41343890-41343912 TTACCACTGTAGGGCCCTGAGGG + Intronic
1184247547 22:43243301-43243323 CTCACCCTGTAGGGCGAGGGTGG + Intronic
1184520630 22:44991823-44991845 TTCACCCTGTAAGGCCAGCGAGG - Intronic
1184665681 22:45987685-45987707 CTCCACCTTTAGGGCCAGGGAGG + Intergenic
1184973374 22:48043483-48043505 TTCCAGCTGGAGGGCCAGGGAGG - Intergenic
950532905 3:13563382-13563404 TTCCCCGTGAAGTGCCTGGGAGG + Intronic
950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG + Intronic
950729944 3:14948111-14948133 TTCCCCCTGACCGGCCCGGCCGG + Intronic
954369181 3:50161283-50161305 TTGCCCCTGGAGGTCCAGGGAGG - Intronic
955485157 3:59427807-59427829 TTCCTCCTGTAGGCTCCAGGAGG - Intergenic
965664838 3:171082206-171082228 TTCCCGCTGTATGGACCTGGGGG + Intronic
975437022 4:74365080-74365102 TCACCCCGTTAGGGCCCGGGAGG + Intergenic
976807440 4:89063617-89063639 TTCCCCTGCTAGGGCCAGGGAGG - Intronic
979087257 4:116428646-116428668 TTTACCCTGTAGGGCCAGAGGGG + Intergenic
985782903 5:1880359-1880381 TTCCCACTGTAGGGGCAGTGTGG + Intronic
989598251 5:43177988-43178010 TTCTCCCTGGAGGTCTCGGGTGG + Intronic
1000294813 5:159903848-159903870 TTCCACCTGTCGGGCCCAGGCGG - Intergenic
1004006429 6:11641499-11641521 TTTCCCCTGAAGGGCAGGGGTGG + Intergenic
1006296934 6:33173916-33173938 TTCCCTCTGTAGGGTCCACGGGG - Exonic
1017914235 6:158819246-158819268 TTCCTGGTGGAGGGCCCGGGCGG - Intronic
1021934992 7:25621528-25621550 CTCCTCCTGCAGGGCCAGGGAGG - Intergenic
1022576135 7:31498637-31498659 TTCCCTCTGTAGGGGCCTTGTGG + Intergenic
1027183797 7:75957603-75957625 TTCCTCTTGTAAGGCCAGGGAGG - Intronic
1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG + Intronic
1049094345 8:140539676-140539698 CTTCCCCTGGAGGGCCCAGGAGG + Intronic
1049153938 8:141055705-141055727 TTCCCTCTGTGCGGCCTGGGCGG - Intergenic
1053006280 9:34606942-34606964 TTCCTCCTGTAGGCCCCAGCTGG + Intergenic
1056846249 9:90040471-90040493 GTCCTCCTTTAGGGCCCAGGAGG - Intergenic
1056902285 9:90611353-90611375 TTCCCCCTGTAAAGTCAGGGCGG + Exonic
1060176112 9:121498798-121498820 TTCCCGCTGTGGCGGCCGGGAGG - Intergenic
1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG + Exonic
1061417123 9:130453165-130453187 TACCCCCAGTAGGGCCCATGGGG + Intronic
1185615512 X:1419416-1419438 TTCACCCTGGAGGCTCCGGGTGG + Intronic
1187174407 X:16883018-16883040 CTCCCCCTGTGGGGACTGGGAGG - Intergenic
1188156511 X:26748758-26748780 TTCCCACAGTGGGGCCTGGGAGG + Intergenic