ID: 1036802567

View in Genome Browser
Species Human (GRCh38)
Location 8:11803079-11803101
Sequence TTCCCCCTGTAGGGCCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036802558_1036802567 -7 Left 1036802558 8:11803063-11803085 CCCCTTTCCTCGAGCCTTCCCCC 0: 1
1: 0
2: 0
3: 24
4: 357
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802556_1036802567 -2 Left 1036802556 8:11803058-11803080 CCGTCCCCCTTTCCTCGAGCCTT 0: 1
1: 0
2: 0
3: 41
4: 432
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802560_1036802567 -9 Left 1036802560 8:11803065-11803087 CCTTTCCTCGAGCCTTCCCCCTG 0: 1
1: 0
2: 1
3: 17
4: 301
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802554_1036802567 9 Left 1036802554 8:11803047-11803069 CCTGGGTGTTCCCGTCCCCCTTT 0: 1
1: 0
2: 2
3: 12
4: 122
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802553_1036802567 15 Left 1036802553 8:11803041-11803063 CCGACGCCTGGGTGTTCCCGTCC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802557_1036802567 -6 Left 1036802557 8:11803062-11803084 CCCCCTTTCCTCGAGCCTTCCCC 0: 1
1: 0
2: 2
3: 28
4: 509
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802559_1036802567 -8 Left 1036802559 8:11803064-11803086 CCCTTTCCTCGAGCCTTCCCCCT 0: 1
1: 0
2: 0
3: 27
4: 325
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1036802555_1036802567 -1 Left 1036802555 8:11803057-11803079 CCCGTCCCCCTTTCCTCGAGCCT 0: 1
1: 0
2: 0
3: 24
4: 299
Right 1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036802567 Original CRISPR TTCCCCCTGTAGGGCCCGGG TGG Intronic