ID: 1036807862

View in Genome Browser
Species Human (GRCh38)
Location 8:11847600-11847622
Sequence CTCTTCGCTGCAGCGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036807847_1036807862 25 Left 1036807847 8:11847552-11847574 CCTCCTCTATCCTAGAGTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807845_1036807862 27 Left 1036807845 8:11847550-11847572 CCCCTCCTCTATCCTAGAGTTCC 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807857_1036807862 -10 Left 1036807857 8:11847587-11847609 CCTCAGCCCTGACCTCTTCGCTG 0: 1
1: 0
2: 0
3: 49
4: 435
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807846_1036807862 26 Left 1036807846 8:11847551-11847573 CCCTCCTCTATCCTAGAGTTCCG 0: 1
1: 0
2: 0
3: 0
4: 97
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807854_1036807862 0 Left 1036807854 8:11847577-11847599 CCCCAAGGCTCCTCAGCCCTGAC 0: 1
1: 0
2: 1
3: 24
4: 275
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807844_1036807862 28 Left 1036807844 8:11847549-11847571 CCCCCTCCTCTATCCTAGAGTTC 0: 1
1: 0
2: 1
3: 19
4: 337
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807855_1036807862 -1 Left 1036807855 8:11847578-11847600 CCCAAGGCTCCTCAGCCCTGACC 0: 1
1: 0
2: 1
3: 28
4: 282
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807856_1036807862 -2 Left 1036807856 8:11847579-11847601 CCAAGGCTCCTCAGCCCTGACCT 0: 1
1: 0
2: 8
3: 32
4: 416
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807853_1036807862 6 Left 1036807853 8:11847571-11847593 CCGGGACCCCAAGGCTCCTCAGC 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807851_1036807862 15 Left 1036807851 8:11847562-11847584 CCTAGAGTTCCGGGACCCCAAGG 0: 1
1: 0
2: 1
3: 14
4: 236
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1036807850_1036807862 22 Left 1036807850 8:11847555-11847577 CCTCTATCCTAGAGTTCCGGGAC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036807862 Original CRISPR CTCTTCGCTGCAGCGTGAGG AGG Intronic
902297394 1:15477044-15477066 CTCTTTACTGCAGCTGGAGGAGG - Intronic
913174784 1:116263555-116263577 CTCTTGGCAGCAGGGGGAGGAGG - Intergenic
924945971 1:248847203-248847225 AACTTAGCTGCAGCGTCAGGAGG + Exonic
1063879058 10:10512193-10512215 CTCTAGGCTTCAGAGTGAGGAGG - Intergenic
1064753058 10:18551812-18551834 CTCTTCACTGCAGTATGTGGTGG - Exonic
1067431120 10:46246771-46246793 CTCTTCACTGCAGAGTGAAGAGG - Intergenic
1067442287 10:46315456-46315478 CTCTTCACTGCAGAGTGAAGAGG + Intronic
1071511290 10:86264164-86264186 CTCTTAGCTCCAGCGTGGGGTGG - Intronic
1071845316 10:89515720-89515742 CTCTGGGCTGGAGAGTGAGGGGG - Intronic
1072617995 10:97062571-97062593 CCCTGCCCTGCAGGGTGAGGAGG + Intronic
1076617279 10:131763886-131763908 CTCTTCTTTGCACCCTGAGGGGG - Intergenic
1083616344 11:64028413-64028435 CTCCACGCTGCAGAGGGAGGAGG + Intronic
1083952382 11:65964104-65964126 CTCCTCGATGCTGAGTGAGGAGG - Exonic
1086432777 11:86751533-86751555 CTCTTCTCTGCAGTGTGGGCAGG - Intergenic
1088908779 11:114174861-114174883 CTCTTCCCTGCAGCTTGACCTGG - Intronic
1089606792 11:119645975-119645997 CTCTTGTCTACAGCCTGAGGTGG + Intronic
1091784396 12:3233972-3233994 CTATTCTCTGCAGCCTGTGGGGG - Intronic
1092047639 12:5443296-5443318 CTCTTGGATGCAGTGGGAGGTGG + Intronic
1095979485 12:47963326-47963348 CACTTCTCTGCTGCGAGAGGAGG - Intergenic
1097755538 12:63403064-63403086 TTCTTTGCTGCAGCATGAGCTGG + Intergenic
1101673565 12:106898100-106898122 CTCTTCACTGTAGAGAGAGGAGG + Intergenic
1112269865 13:97958775-97958797 ATCTTGGCTGCAGTGTGGGGTGG - Intronic
1113809955 13:113134295-113134317 TTCTTCACAGCAGCGTGAGAAGG - Intronic
1121404723 14:93712731-93712753 CTCTTCCCTGCAGGGTGTGCAGG + Intergenic
1202904047 14_GL000194v1_random:58498-58520 GTCGGAGCTGCAGCGTGAGGTGG - Intergenic
1124022973 15:25940536-25940558 TTCTTCTCTGCAGCGTGACATGG + Intergenic
1124251121 15:28106996-28107018 CGCTTCGCTGCCGCGCGGGGAGG + Intergenic
1127671345 15:61197867-61197889 ATCTTCCCTTCAGCGTGTGGTGG - Intronic
1130883380 15:88073783-88073805 CTCTTCCCTGCGGGGTGGGGCGG - Intronic
1132282971 15:100635945-100635967 CTCATGGCTCCAGCATGAGGAGG - Intronic
1132499553 16:279493-279515 CCCTTCGCTGCAGGGAGCGGGGG - Intronic
1135861073 16:26056559-26056581 CTCTTCCCTCTAGTGTGAGGTGG + Intronic
1136635834 16:31522317-31522339 CTCTGCTCTGCAGTGTGGGGTGG + Intergenic
1137732469 16:50698861-50698883 CTCTTCGAAGCAGGGTGAGAGGG - Intronic
1139407935 16:66734302-66734324 GTCTTCCCTGCAGTGTGATGCGG - Exonic
1139510901 16:67428091-67428113 CTCTTAGCTGCAGAGGGAAGAGG + Intergenic
1143295357 17:5867308-5867330 CTCTTGGCTGCAGCCTGGGGAGG + Intronic
1143375165 17:6462967-6462989 CCCTTCCCTGCAGTGGGAGGGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1144952118 17:19000038-19000060 CACTTGGCTGCAGCCTGAGAAGG - Intronic
1144956086 17:19019637-19019659 CTCTTCCCTGCTGCCTGTGGGGG + Intronic
1146624360 17:34424499-34424521 CTCTTCTCCGCGGAGTGAGGAGG - Intergenic
1147158665 17:38558535-38558557 CCCTTCGCTGCTGCCTGAGGCGG - Intronic
1148170377 17:45514510-45514532 CTCTTCGCTGCAGAGAACGGAGG + Intergenic
1148170854 17:45518503-45518525 CTCTTCGCTGCAGAGAACGGAGG + Intergenic
1148365171 17:47050052-47050074 CTCTTCGCTGCAGAGAACGGAGG - Intergenic
1151651889 17:75475352-75475374 TTCTTCCCTGCAGCTTGAGATGG + Intronic
1152240881 17:79160368-79160390 CTCTGCCCTGCAGCTTGAGGTGG - Intronic
1153387273 18:4511472-4511494 CTCTTGGCTGCATCTTAAGGAGG - Intergenic
1154390810 18:13934566-13934588 CTCTTCTCTGCAGTGTGGGCAGG + Intergenic
1157782710 18:50454282-50454304 CTCAGCCCTGCAGCCTGAGGGGG - Intergenic
1157969990 18:52255561-52255583 GTCTTCGTAGCAGCGTGAGAAGG + Intergenic
1158625730 18:59070066-59070088 CTCATCGCTGCAAATTGAGGGGG - Intergenic
1159257626 18:65967693-65967715 CTCATCTCAGCAGCTTGAGGTGG - Intergenic
1160011210 18:75108221-75108243 CAGTTCGAGGCAGCGTGAGGTGG + Intergenic
1160184807 18:76667721-76667743 GTCTTGGCGGCAGCGTGAGGAGG - Intergenic
1161037787 19:2095360-2095382 CTCTTCGCTGCAGGGAGGAGGGG + Intronic
1164836061 19:31355846-31355868 TTCCTCGCTGCAGCGTGGCGTGG + Intergenic
926107792 2:10163227-10163249 CTCTTGGCTGCAGGGAGAGGGGG + Intronic
930159457 2:48139241-48139263 CTCTTCCCTGCATGATGAGGAGG + Intergenic
933042214 2:77483626-77483648 CTCTTCCCTGCTGGGTGCGGTGG - Intronic
934735288 2:96686943-96686965 CTCTTCCCTGGACCGTGACGGGG + Intergenic
934818321 2:97349819-97349841 CCCTTCTCTGCAGCCTCAGGTGG - Intergenic
938313986 2:130314115-130314137 GTCGGAGCTGCAGCGTGAGGTGG - Intergenic
944709719 2:202324801-202324823 CTCTTCAGTGCATCATGAGGAGG - Intergenic
945829633 2:214767539-214767561 TTCTTGGCTGCATCGTGAAGTGG + Exonic
946357699 2:219198898-219198920 ATCTTCCCTGCAGGGTGAGGTGG + Intronic
947592961 2:231395659-231395681 CTCTTCCCGGCCGCGGGAGGAGG - Exonic
1174039435 20:47688571-47688593 CTCATCCCTGCAGCGGGTGGAGG - Intronic
1175149970 20:56925739-56925761 CTCTTGGCTGCATCGGGAGACGG - Intergenic
1176413813 21:6463467-6463489 CGCTGGGCTGCAGCGTAAGGAGG + Intergenic
1179054900 21:37922248-37922270 CACTCAGCTGCAGCGTGAAGTGG - Intergenic
1179689311 21:43071789-43071811 CGCTGGGCTGCAGCGTAAGGAGG + Intronic
1179821181 21:43938000-43938022 GTCCTCGCTGCAGAGGGAGGAGG + Intronic
1181161380 22:20961968-20961990 CTTTTCCCTGCAGGCTGAGGCGG - Intergenic
1184117523 22:42430998-42431020 CTCTGGGCTGCAGCCTGGGGAGG + Intronic
1184378741 22:44131855-44131877 CTCTCCTCTGCAGCATGGGGAGG - Intronic
951426922 3:22557212-22557234 CTCTTCCCTGCAGCCAGAGAAGG + Intergenic
966947646 3:184788497-184788519 CTCTTCGCTGCAGGATGACTTGG + Intergenic
968948774 4:3679506-3679528 CTCTCCGCTGCACCGAGATGAGG - Intergenic
983249363 4:165327382-165327404 CTCCGCGCTGCAGGGCGAGGCGG + Intergenic
991630644 5:68653507-68653529 CTCTTCCCTTCAGCAAGAGGAGG + Intergenic
992807495 5:80351867-80351889 CGCTGCGCTCCAGCGTGAGCAGG - Intergenic
995067988 5:107883809-107883831 CATTTCCCTGAAGCGTGAGGGGG - Intronic
996878221 5:128263343-128263365 CTCTTCCCTGCAGTGGGGGGTGG + Intronic
1003426747 6:6002945-6002967 GTCTCGGCTGCAGCGTGCGGGGG + Intronic
1010487509 6:76433094-76433116 ATCTTAGCTGCTGCCTGAGGTGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1013982228 6:116145158-116145180 CTTCTCACTGCAGAGTGAGGAGG - Intronic
1018873010 6:167797193-167797215 CTCCTCGCTGTAGGGTGGGGAGG - Intergenic
1022505283 7:30905757-30905779 GTCCTTGCTGCAGCCTGAGGAGG + Intergenic
1023189432 7:37563640-37563662 CTCTGTGGTGCAGGGTGAGGGGG + Intergenic
1023278827 7:38548648-38548670 CTCTCTGCTGCAGAGAGAGGGGG + Intronic
1023865084 7:44234670-44234692 CTCTTGGCTGCTGCATGGGGAGG + Exonic
1031905629 7:127457429-127457451 CACATGGCTGCAGCTTGAGGTGG - Intergenic
1034307447 7:150056653-150056675 CTCTCAGCTGCAGCGGGATGAGG + Intergenic
1034799399 7:154044039-154044061 CTCTCAGCTGCAGCGGGATGAGG - Intronic
1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG + Intronic
1039998989 8:42560720-42560742 CTCTTCACTGCTGAGAGAGGAGG - Intergenic
1042224381 8:66504139-66504161 CTCTTCTCTGCACAGTGGGGAGG - Intronic
1045674082 8:104589021-104589043 CTCTCCGCGGCTGCGGGAGGGGG + Intronic
1048004801 8:130410706-130410728 CCCTGGGCTGCAGCATGAGGGGG - Intronic
1049679613 8:143912036-143912058 CTCTCCACTGCACCGGGAGGAGG + Intergenic
1055788262 9:79894410-79894432 CTTGTCACTGCAGTGTGAGGTGG - Intergenic
1057152287 9:92807187-92807209 CCCTCCGCTGCAGCGAGAGTGGG + Intergenic
1058380769 9:104374831-104374853 CTCTCCCCTGCAGCCTGAGAGGG - Intergenic
1060826987 9:126693257-126693279 CTCTTCGCTGCTGCGTGGTGAGG - Exonic
1061654678 9:132079755-132079777 CGCTGCGCTCCAGCGTGAGCAGG - Exonic
1203563506 Un_KI270744v1:75787-75809 GTCAGAGCTGCAGCGTGAGGTGG + Intergenic
1186406796 X:9311620-9311642 CTCCTCTCTGCAGCTGGAGGTGG - Intergenic
1190329209 X:49225438-49225460 CTCTTCGCTGCTTCATGAAGTGG + Intronic
1195954835 X:110317964-110317986 CTCTCCGCTGCAGTGGGAGGAGG + Exonic