ID: 1036812940

View in Genome Browser
Species Human (GRCh38)
Location 8:11880147-11880169
Sequence ATAGGAGTCAGGGGAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812940_1036812946 -3 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812946 8:11880167-11880189 TATAGTGGTTTCCCCTCTGAAGG No data
1036812940_1036812957 30 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812957 8:11880200-11880222 ACCTCCTGAGGGTCTTCTTAGGG No data
1036812940_1036812950 7 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812950 8:11880177-11880199 TCCCCTCTGAAGGGGCTTCAGGG No data
1036812940_1036812954 18 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812954 8:11880188-11880210 GGGGCTTCAGGGACCTCCTGAGG No data
1036812940_1036812956 29 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812956 8:11880199-11880221 GACCTCCTGAGGGTCTTCTTAGG No data
1036812940_1036812949 6 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812949 8:11880176-11880198 TTCCCCTCTGAAGGGGCTTCAGG No data
1036812940_1036812955 19 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812940_1036812948 -1 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812948 8:11880169-11880191 TAGTGGTTTCCCCTCTGAAGGGG No data
1036812940_1036812947 -2 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812947 8:11880168-11880190 ATAGTGGTTTCCCCTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812940 Original CRISPR ATAGGAGTCAGGGGAGCTCC AGG (reversed) Intergenic