ID: 1036812943

View in Genome Browser
Species Human (GRCh38)
Location 8:11880157-11880179
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812943_1036812950 -3 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812950 8:11880177-11880199 TCCCCTCTGAAGGGGCTTCAGGG No data
1036812943_1036812949 -4 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812949 8:11880176-11880198 TTCCCCTCTGAAGGGGCTTCAGG No data
1036812943_1036812956 19 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812956 8:11880199-11880221 GACCTCCTGAGGGTCTTCTTAGG No data
1036812943_1036812955 9 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812943_1036812963 30 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812963 8:11880210-11880232 GGTCTTCTTAGGGGTCTCTGGGG No data
1036812943_1036812961 28 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812961 8:11880208-11880230 AGGGTCTTCTTAGGGGTCTCTGG No data
1036812943_1036812959 21 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812959 8:11880201-11880223 CCTCCTGAGGGTCTTCTTAGGGG No data
1036812943_1036812957 20 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812957 8:11880200-11880222 ACCTCCTGAGGGTCTTCTTAGGG No data
1036812943_1036812954 8 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812954 8:11880188-11880210 GGGGCTTCAGGGACCTCCTGAGG No data
1036812943_1036812962 29 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812943 Original CRISPR GGAAACCACTATAGGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr