ID: 1036812948

View in Genome Browser
Species Human (GRCh38)
Location 8:11880169-11880191
Sequence TAGTGGTTTCCCCTCTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812940_1036812948 -1 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812948 8:11880169-11880191 TAGTGGTTTCCCCTCTGAAGGGG No data
1036812939_1036812948 0 Left 1036812939 8:11880146-11880168 CCCTGGAGCTCCCCTGACTCCTA No data
Right 1036812948 8:11880169-11880191 TAGTGGTTTCCCCTCTGAAGGGG No data
1036812942_1036812948 -10 Left 1036812942 8:11880156-11880178 CCCCTGACTCCTATAGTGGTTTC No data
Right 1036812948 8:11880169-11880191 TAGTGGTTTCCCCTCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812948 Original CRISPR TAGTGGTTTCCCCTCTGAAG GGG Intergenic
No off target data available for this crispr