ID: 1036812951

View in Genome Browser
Species Human (GRCh38)
Location 8:11880178-11880200
Sequence TCCCTGAAGCCCCTTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812951_1036812963 9 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812963 8:11880210-11880232 GGTCTTCTTAGGGGTCTCTGGGG No data
1036812951_1036812956 -2 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812956 8:11880199-11880221 GACCTCCTGAGGGTCTTCTTAGG No data
1036812951_1036812961 7 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812961 8:11880208-11880230 AGGGTCTTCTTAGGGGTCTCTGG No data
1036812951_1036812959 0 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812959 8:11880201-11880223 CCTCCTGAGGGTCTTCTTAGGGG No data
1036812951_1036812957 -1 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812957 8:11880200-11880222 ACCTCCTGAGGGTCTTCTTAGGG No data
1036812951_1036812962 8 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812951 Original CRISPR TCCCTGAAGCCCCTTCAGAG GGG (reversed) Intergenic
No off target data available for this crispr