ID: 1036812955

View in Genome Browser
Species Human (GRCh38)
Location 8:11880189-11880211
Sequence GGGCTTCAGGGACCTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812945_1036812955 1 Left 1036812945 8:11880165-11880187 CCTATAGTGGTTTCCCCTCTGAA No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812939_1036812955 20 Left 1036812939 8:11880146-11880168 CCCTGGAGCTCCCCTGACTCCTA No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812943_1036812955 9 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812942_1036812955 10 Left 1036812942 8:11880156-11880178 CCCCTGACTCCTATAGTGGTTTC No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812940_1036812955 19 Left 1036812940 8:11880147-11880169 CCTGGAGCTCCCCTGACTCCTAT No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data
1036812944_1036812955 8 Left 1036812944 8:11880158-11880180 CCTGACTCCTATAGTGGTTTCCC No data
Right 1036812955 8:11880189-11880211 GGGCTTCAGGGACCTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812955 Original CRISPR GGGCTTCAGGGACCTCCTGA GGG Intergenic
No off target data available for this crispr