ID: 1036812960

View in Genome Browser
Species Human (GRCh38)
Location 8:11880204-11880226
Sequence AGACCCCTAAGAAGACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812960_1036812969 25 Left 1036812960 8:11880204-11880226 CCTGAGGGTCTTCTTAGGGGTCT No data
Right 1036812969 8:11880252-11880274 AGGGATGCCTTAGTGTCCTTTGG No data
1036812960_1036812964 5 Left 1036812960 8:11880204-11880226 CCTGAGGGTCTTCTTAGGGGTCT No data
Right 1036812964 8:11880232-11880254 GCAGCCCGAATGAGCCACACAGG No data
1036812960_1036812965 6 Left 1036812960 8:11880204-11880226 CCTGAGGGTCTTCTTAGGGGTCT No data
Right 1036812965 8:11880233-11880255 CAGCCCGAATGAGCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812960 Original CRISPR AGACCCCTAAGAAGACCCTC AGG (reversed) Intergenic
No off target data available for this crispr