ID: 1036812962

View in Genome Browser
Species Human (GRCh38)
Location 8:11880209-11880231
Sequence GGGTCTTCTTAGGGGTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812952_1036812962 7 Left 1036812952 8:11880179-11880201 CCCTCTGAAGGGGCTTCAGGGAC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812943_1036812962 29 Left 1036812943 8:11880157-11880179 CCCTGACTCCTATAGTGGTTTCC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812945_1036812962 21 Left 1036812945 8:11880165-11880187 CCTATAGTGGTTTCCCCTCTGAA No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812942_1036812962 30 Left 1036812942 8:11880156-11880178 CCCCTGACTCCTATAGTGGTTTC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812953_1036812962 6 Left 1036812953 8:11880180-11880202 CCTCTGAAGGGGCTTCAGGGACC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812944_1036812962 28 Left 1036812944 8:11880158-11880180 CCTGACTCCTATAGTGGTTTCCC No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data
1036812951_1036812962 8 Left 1036812951 8:11880178-11880200 CCCCTCTGAAGGGGCTTCAGGGA No data
Right 1036812962 8:11880209-11880231 GGGTCTTCTTAGGGGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812962 Original CRISPR GGGTCTTCTTAGGGGTCTCT GGG Intergenic
No off target data available for this crispr