ID: 1036812964

View in Genome Browser
Species Human (GRCh38)
Location 8:11880232-11880254
Sequence GCAGCCCGAATGAGCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812952_1036812964 30 Left 1036812952 8:11880179-11880201 CCCTCTGAAGGGGCTTCAGGGAC No data
Right 1036812964 8:11880232-11880254 GCAGCCCGAATGAGCCACACAGG No data
1036812953_1036812964 29 Left 1036812953 8:11880180-11880202 CCTCTGAAGGGGCTTCAGGGACC No data
Right 1036812964 8:11880232-11880254 GCAGCCCGAATGAGCCACACAGG No data
1036812960_1036812964 5 Left 1036812960 8:11880204-11880226 CCTGAGGGTCTTCTTAGGGGTCT No data
Right 1036812964 8:11880232-11880254 GCAGCCCGAATGAGCCACACAGG No data
1036812958_1036812964 8 Left 1036812958 8:11880201-11880223 CCTCCTGAGGGTCTTCTTAGGGG No data
Right 1036812964 8:11880232-11880254 GCAGCCCGAATGAGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812964 Original CRISPR GCAGCCCGAATGAGCCACAC AGG Intergenic
No off target data available for this crispr