ID: 1036812965

View in Genome Browser
Species Human (GRCh38)
Location 8:11880233-11880255
Sequence CAGCCCGAATGAGCCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036812958_1036812965 9 Left 1036812958 8:11880201-11880223 CCTCCTGAGGGTCTTCTTAGGGG No data
Right 1036812965 8:11880233-11880255 CAGCCCGAATGAGCCACACAGGG No data
1036812953_1036812965 30 Left 1036812953 8:11880180-11880202 CCTCTGAAGGGGCTTCAGGGACC No data
Right 1036812965 8:11880233-11880255 CAGCCCGAATGAGCCACACAGGG No data
1036812960_1036812965 6 Left 1036812960 8:11880204-11880226 CCTGAGGGTCTTCTTAGGGGTCT No data
Right 1036812965 8:11880233-11880255 CAGCCCGAATGAGCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036812965 Original CRISPR CAGCCCGAATGAGCCACACA GGG Intergenic
No off target data available for this crispr