ID: 1036814378

View in Genome Browser
Species Human (GRCh38)
Location 8:11890338-11890360
Sequence CAGGTTCCTCCCACGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036814378_1036814384 0 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814384 8:11890361-11890383 GTGGGCAGTGATTGAATAATGGG No data
1036814378_1036814386 2 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814386 8:11890363-11890385 GGGCAGTGATTGAATAATGGGGG No data
1036814378_1036814385 1 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814385 8:11890362-11890384 TGGGCAGTGATTGAATAATGGGG No data
1036814378_1036814387 6 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814387 8:11890367-11890389 AGTGATTGAATAATGGGGGCAGG No data
1036814378_1036814383 -1 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036814378 Original CRISPR CAGGTTCCTCCCACGACACA TGG (reversed) Intergenic