ID: 1036814383 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:11890360-11890382 |
| Sequence | GGTGGGCAGTGATTGAATAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1036814377_1036814383 | 0 | Left | 1036814377 | 8:11890337-11890359 | CCCATGTGTCGTGGGAGGAACCT | No data | ||
| Right | 1036814383 | 8:11890360-11890382 | GGTGGGCAGTGATTGAATAATGG | No data | ||||
| 1036814378_1036814383 | -1 | Left | 1036814378 | 8:11890338-11890360 | CCATGTGTCGTGGGAGGAACCTG | No data | ||
| Right | 1036814383 | 8:11890360-11890382 | GGTGGGCAGTGATTGAATAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1036814383 | Original CRISPR | GGTGGGCAGTGATTGAATAA TGG | Intergenic | ||