ID: 1036814383

View in Genome Browser
Species Human (GRCh38)
Location 8:11890360-11890382
Sequence GGTGGGCAGTGATTGAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036814378_1036814383 -1 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG 0: 13
1: 182
2: 1219
3: 2934
4: 8668
Right 1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG No data
1036814377_1036814383 0 Left 1036814377 8:11890337-11890359 CCCATGTGTCGTGGGAGGAACCT 0: 13
1: 201
2: 1450
3: 4003
4: 6657
Right 1036814383 8:11890360-11890382 GGTGGGCAGTGATTGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036814383 Original CRISPR GGTGGGCAGTGATTGAATAA TGG Intergenic
No off target data available for this crispr