ID: 1036814384 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:11890361-11890383 |
Sequence | GTGGGCAGTGATTGAATAAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1036814378_1036814384 | 0 | Left | 1036814378 | 8:11890338-11890360 | CCATGTGTCGTGGGAGGAACCTG | No data | ||
Right | 1036814384 | 8:11890361-11890383 | GTGGGCAGTGATTGAATAATGGG | No data | ||||
1036814377_1036814384 | 1 | Left | 1036814377 | 8:11890337-11890359 | CCCATGTGTCGTGGGAGGAACCT | No data | ||
Right | 1036814384 | 8:11890361-11890383 | GTGGGCAGTGATTGAATAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1036814384 | Original CRISPR | GTGGGCAGTGATTGAATAAT GGG | Intergenic | ||