ID: 1036814384

View in Genome Browser
Species Human (GRCh38)
Location 8:11890361-11890383
Sequence GTGGGCAGTGATTGAATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036814377_1036814384 1 Left 1036814377 8:11890337-11890359 CCCATGTGTCGTGGGAGGAACCT No data
Right 1036814384 8:11890361-11890383 GTGGGCAGTGATTGAATAATGGG No data
1036814378_1036814384 0 Left 1036814378 8:11890338-11890360 CCATGTGTCGTGGGAGGAACCTG No data
Right 1036814384 8:11890361-11890383 GTGGGCAGTGATTGAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036814384 Original CRISPR GTGGGCAGTGATTGAATAAT GGG Intergenic