ID: 1036816608

View in Genome Browser
Species Human (GRCh38)
Location 8:11907281-11907303
Sequence AAGGGCCTATTGAACTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036816608_1036816613 9 Left 1036816608 8:11907281-11907303 CCCTCAGAGTTCAATAGGCCCTT No data
Right 1036816613 8:11907313-11907335 TCACGCTCCATGCACTTGAAGGG No data
1036816608_1036816616 27 Left 1036816608 8:11907281-11907303 CCCTCAGAGTTCAATAGGCCCTT No data
Right 1036816616 8:11907331-11907353 AAGGGTTAAAAAGACATACCGGG No data
1036816608_1036816612 8 Left 1036816608 8:11907281-11907303 CCCTCAGAGTTCAATAGGCCCTT No data
Right 1036816612 8:11907312-11907334 ATCACGCTCCATGCACTTGAAGG No data
1036816608_1036816615 26 Left 1036816608 8:11907281-11907303 CCCTCAGAGTTCAATAGGCCCTT No data
Right 1036816615 8:11907330-11907352 GAAGGGTTAAAAAGACATACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036816608 Original CRISPR AAGGGCCTATTGAACTCTGA GGG (reversed) Intergenic
No off target data available for this crispr