ID: 1036826044

View in Genome Browser
Species Human (GRCh38)
Location 8:11977061-11977083
Sequence GCACCAGTGTTAGCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036826040_1036826044 4 Left 1036826040 8:11977034-11977056 CCTTGGGTCACTGGATGGTGTAT No data
Right 1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036826044 Original CRISPR GCACCAGTGTTAGCAGGTCC AGG Intergenic
No off target data available for this crispr