ID: 1036826228

View in Genome Browser
Species Human (GRCh38)
Location 8:11978187-11978209
Sequence AGAGCCTGACAGCTCCCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036826228_1036826230 -6 Left 1036826228 8:11978187-11978209 CCAGACGGGAGCTGTCAGGCTCT No data
Right 1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG No data
1036826228_1036826237 25 Left 1036826228 8:11978187-11978209 CCAGACGGGAGCTGTCAGGCTCT No data
Right 1036826237 8:11978235-11978257 TGTCCCTGCGAGAGTCTCCTGGG No data
1036826228_1036826236 24 Left 1036826228 8:11978187-11978209 CCAGACGGGAGCTGTCAGGCTCT No data
Right 1036826236 8:11978234-11978256 TTGTCCCTGCGAGAGTCTCCTGG No data
1036826228_1036826231 -5 Left 1036826228 8:11978187-11978209 CCAGACGGGAGCTGTCAGGCTCT No data
Right 1036826231 8:11978205-11978227 GCTCTGGAAAGCTCCCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036826228 Original CRISPR AGAGCCTGACAGCTCCCGTC TGG (reversed) Intergenic
No off target data available for this crispr