ID: 1036826230

View in Genome Browser
Species Human (GRCh38)
Location 8:11978204-11978226
Sequence GGCTCTGGAAAGCTCCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036826228_1036826230 -6 Left 1036826228 8:11978187-11978209 CCAGACGGGAGCTGTCAGGCTCT No data
Right 1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG No data
1036826227_1036826230 -5 Left 1036826227 8:11978186-11978208 CCCAGACGGGAGCTGTCAGGCTC No data
Right 1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036826230 Original CRISPR GGCTCTGGAAAGCTCCCAGT AGG Intergenic
No off target data available for this crispr