ID: 1036828755

View in Genome Browser
Species Human (GRCh38)
Location 8:12002910-12002932
Sequence GTGATCAAGTCCTAGATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036828754_1036828755 14 Left 1036828754 8:12002873-12002895 CCTTGTATCTCTTCTTTCTTTTT No data
Right 1036828755 8:12002910-12002932 GTGATCAAGTCCTAGATTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036828755 Original CRISPR GTGATCAAGTCCTAGATTAC TGG Intergenic
No off target data available for this crispr