ID: 1036838804

View in Genome Browser
Species Human (GRCh38)
Location 8:12098908-12098930
Sequence GTCTTGTAGAATTTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036838804_1036838809 9 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838809 8:12098940-12098962 AGAAGGAAGAGGGAAAGCCAGGG No data
1036838804_1036838810 13 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838810 8:12098944-12098966 GGAAGAGGGAAAGCCAGGGATGG No data
1036838804_1036838814 30 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838814 8:12098961-12098983 GGATGGAGATGGAGCCTTAAGGG 0: 6
1: 0
2: 1
3: 17
4: 260
1036838804_1036838808 8 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838808 8:12098939-12098961 GAGAAGGAAGAGGGAAAGCCAGG No data
1036838804_1036838806 -2 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838806 8:12098929-12098951 ACTAGATGCTGAGAAGGAAGAGG 0: 6
1: 0
2: 9
3: 76
4: 675
1036838804_1036838811 19 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838811 8:12098950-12098972 GGGAAAGCCAGGGATGGAGATGG No data
1036838804_1036838813 29 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838813 8:12098960-12098982 GGGATGGAGATGGAGCCTTAAGG 0: 6
1: 0
2: 1
3: 38
4: 401
1036838804_1036838807 -1 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838807 8:12098930-12098952 CTAGATGCTGAGAAGGAAGAGGG 0: 6
1: 0
2: 7
3: 36
4: 515
1036838804_1036838805 -8 Left 1036838804 8:12098908-12098930 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036838805 8:12098923-12098945 TACAAGACTAGATGCTGAGAAGG 0: 6
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036838804 Original CRISPR GTCTTGTAGAATTTAAACAC AGG (reversed) Intergenic
No off target data available for this crispr