ID: 1036840222

View in Genome Browser
Species Human (GRCh38)
Location 8:12115714-12115736
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 7, 1: 0, 2: 2, 3: 23, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036840216_1036840222 27 Left 1036840216 8:12115664-12115686 CCACACCTGAATTTCAGTGATTC 0: 5
1: 0
2: 1
3: 15
4: 253
Right 1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG 0: 7
1: 0
2: 2
3: 23
4: 184
1036840217_1036840222 22 Left 1036840217 8:12115669-12115691 CCTGAATTTCAGTGATTCAGACT 0: 7
1: 0
2: 0
3: 17
4: 218
Right 1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG 0: 7
1: 0
2: 2
3: 23
4: 184
1036840220_1036840222 -9 Left 1036840220 8:12115700-12115722 CCGCTAAGACCAAACGTCCTGTG 0: 3
1: 4
2: 0
3: 5
4: 116
Right 1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG 0: 7
1: 0
2: 2
3: 23
4: 184
1036840219_1036840222 -6 Left 1036840219 8:12115697-12115719 CCACCGCTAAGACCAAACGTCCT 0: 3
1: 3
2: 0
3: 2
4: 25
Right 1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG 0: 7
1: 0
2: 2
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036840222 Original CRISPR CGTCCTGTGCTGCCACCTCA TGG Intergenic
900339342 1:2180724-2180746 GCTGCTGTGCTGCCACCCCAGGG + Intronic
900475232 1:2873364-2873386 CTTCCAGTTCTGCCCCCTCAAGG + Intergenic
901455535 1:9360902-9360924 CTCCCTGTGCTGCCACCTGTGGG + Intronic
901842868 1:11964791-11964813 CGTCCTGTGCTGCCCGCTCCTGG - Intronic
902541945 1:17162172-17162194 CCTCCAGCGCTGTCACCTCATGG + Intergenic
905434440 1:37946989-37947011 CCTCCTGAGCTGTCACCACAGGG + Exonic
906666334 1:47624697-47624719 CTTCCCCTGCTGCCACCTCCTGG + Intergenic
907311489 1:53541434-53541456 GGCCCTGTGCTGGCATCTCACGG + Intronic
909392995 1:75136726-75136748 CGTCCTGCGCCGCCTCCCCACGG - Intronic
909853890 1:80504427-80504449 CGCCCTGTGCTTCCACCTGATGG + Intergenic
912632342 1:111256546-111256568 CCACCTGTGCTGCCACCCCCAGG - Intergenic
915802187 1:158806065-158806087 CTTCTAGTGCTGCCACCACAGGG + Intergenic
916186106 1:162134824-162134846 AGTCATGTGCAGCCACCTAAGGG - Intronic
918124576 1:181571620-181571642 GGTCCCTTGCTGCCTCCTCATGG + Intronic
924091226 1:240503060-240503082 CATCCTGTGCTTGCCCCTCATGG - Intronic
1063040885 10:2336285-2336307 TGTCCTGTGCTCTCACCACATGG - Intergenic
1063380570 10:5582966-5582988 CGTCTTGTGCTGCCATATCCTGG - Intergenic
1067699124 10:48555968-48555990 CGTCCAGTCCTGCCACGTCTTGG + Intronic
1069705456 10:70456594-70456616 GGTCCTGAGCTGCCCCATCAGGG + Intergenic
1069917828 10:71798194-71798216 CCTCCTGTGCTGCAGCCTGAGGG + Intronic
1074128094 10:110546337-110546359 AGTCCAGTCCTGGCACCTCAAGG + Intergenic
1074776626 10:116772070-116772092 CGTCCTGTGCTGTCATCTCAGGG - Intergenic
1076555693 10:131319962-131319984 CGTCCAGAGTTGCCACCTCTTGG - Intergenic
1076720456 10:132390086-132390108 GGTCCTGTGCTGCTCCCTCCAGG - Intergenic
1077178786 11:1203158-1203180 CTGACTGTGCTGCCACCTCGTGG - Intergenic
1077198589 11:1293785-1293807 CGTCCTCAGCCGCCACCTCCTGG - Intronic
1077367274 11:2166281-2166303 CGGCCTGTGCTGCCACCTGCCGG - Intronic
1077518102 11:3014364-3014386 CGTCCTGTGCCCACACATCATGG - Intronic
1078722182 11:13895401-13895423 CACCCTGTGCTGCCTCCTCAGGG + Intergenic
1084837601 11:71813928-71813950 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1085046045 11:73354294-73354316 CATCCTGTGCTGACCCCTCCGGG - Intronic
1085442810 11:76579131-76579153 AGGCCTGTGCTGCCCCCTCCTGG - Intergenic
1088221685 11:107576677-107576699 CTTCCACTGCTGCCACCTCCTGG - Intergenic
1088755378 11:112881464-112881486 CCTTGTGTGCTGCAACCTCAAGG - Intergenic
1090479876 11:127058725-127058747 CCTGCTGTGCTCCCACCTCAGGG + Intergenic
1091221457 11:133932003-133932025 AGTACTGTGATGCCACCTCTGGG - Intronic
1092101945 12:5890671-5890693 CTTCCCCTGCTGCCTCCTCAGGG - Intronic
1092401099 12:8180141-8180163 CGTCCTGTGCTGCCACCTCATGG + Intronic
1094215830 12:27940970-27940992 TCTCCTGTGCTGCCACCTCGTGG + Intergenic
1095600144 12:44003967-44003989 GGTCCTGTTCTACAACCTCAGGG + Intronic
1097185420 12:57194021-57194043 CGCCCTTTGCTGGCACCTCCTGG + Intronic
1101894519 12:108745891-108745913 CCTTCTCTGATGCCACCTCATGG + Intergenic
1104786876 12:131455730-131455752 TGTCCTGTGCCCCCACCCCATGG - Intergenic
1106095498 13:26639814-26639836 CGTCCCGCTCTGCCTCCTCAAGG - Intronic
1106311336 13:28557114-28557136 CCTCCTGTGAAGCCACCTCTGGG + Intergenic
1109466367 13:62738066-62738088 CATCCTGTGTTTCCACCCCACGG + Intergenic
1112277324 13:98033469-98033491 GCTCCTCTGCTGCCCCCTCAAGG - Intergenic
1114272070 14:21107020-21107042 TGTCCTCTGCTGCCATCTCGTGG + Intergenic
1114450329 14:22821310-22821332 CTTGCTGTGCGGCCACCGCAGGG - Intronic
1115771331 14:36666285-36666307 CCTCCTGTGCTTCCAGCCCAGGG - Intronic
1117068379 14:52033338-52033360 CTTCCTGTCCTTCCACTTCACGG - Intronic
1118298028 14:64588326-64588348 CCACCTGGGATGCCACCTCAAGG - Intronic
1119506352 14:75176354-75176376 CGGCCTGCGCAGCCACCTCAAGG - Exonic
1122541547 14:102500417-102500439 GGTCCAGGGCTGCCTCCTCATGG + Exonic
1122631861 14:103110944-103110966 CCTCCATTGCTGACACCTCAGGG - Intergenic
1122687918 14:103518732-103518754 CAGCCTGTGCTGCCACCTGCTGG - Intergenic
1122813477 14:104300652-104300674 CGTCCACTGGTGCCTCCTCACGG - Intergenic
1129255093 15:74329932-74329954 CGTCCTGTGATACCAACTCAGGG - Intronic
1131120975 15:89823368-89823390 CCTGCCCTGCTGCCACCTCAGGG - Intergenic
1132636411 16:952021-952043 CAGCCTGTGCTGACAGCTCATGG + Intronic
1133412794 16:5582186-5582208 CTTCCTGTGGTGCAACCTCATGG - Intergenic
1136534587 16:30892474-30892496 CGTCTTGTGCACCCTCCTCAAGG - Intronic
1136777392 16:32879198-32879220 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1136893233 16:33982315-33982337 CCTCCTGGGCTGCCTCCTCAGGG + Intergenic
1137792368 16:51185770-51185792 CCTCCTGTCCTGTCCCCTCAGGG + Intergenic
1138542410 16:57696335-57696357 CCTCATGTGTGGCCACCTCATGG + Intronic
1139003692 16:62545218-62545240 CCTCCTCTGCTGCCACCACCTGG + Intergenic
1139752986 16:69120358-69120380 CGTGCTCCGCTGCCACCTCGAGG - Exonic
1203079805 16_KI270728v1_random:1141307-1141329 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1142644853 17:1305031-1305053 CCGGCTGTGCTGCCACCTCCGGG - Intergenic
1143253998 17:5542459-5542481 CTTCTGGTGCTGACACCTCATGG + Intronic
1147073647 17:37978524-37978546 AGCCGTGTGCTCCCACCTCAGGG - Intronic
1147286807 17:39408885-39408907 CCTCATCTGCTTCCACCTCAGGG - Exonic
1147333338 17:39711983-39712005 CATCCTCTGCTGTCACCTCTTGG - Exonic
1147482716 17:40782272-40782294 CTTCCTGTGCTGCCTTCACAGGG - Exonic
1148219719 17:45852869-45852891 GCTCCTGTGCTGCCACCTACTGG + Intergenic
1149786624 17:59440961-59440983 CGCCCTGTGCTGCCACCTAGTGG + Intergenic
1152569374 17:81115010-81115032 TGTCCTGTGCTGTCCCCTCCGGG + Intronic
1152895365 17:82907846-82907868 GGTCCTGTGATGCCTCCTGAGGG - Intronic
1156360031 18:36377041-36377063 TCACCTGAGCTGCCACCTCATGG - Intronic
1157152552 18:45232755-45232777 CCTCCTGTGTAGCCAGCTCAAGG + Intronic
1157248562 18:46073631-46073653 CGTCCTCTGCTGCCCCTTGATGG - Intergenic
1160532862 18:79575793-79575815 GGTACAGTGCGGCCACCTCAGGG + Intergenic
1160800675 19:966633-966655 CTGCCTGGGCTGCCACCACAGGG - Exonic
1160987042 19:1843842-1843864 CGTCCTGTGCTGCCTCCTCCTGG - Intronic
1161162897 19:2770456-2770478 CTTCCTGAGCTGGCGCCTCAAGG - Intronic
1161504535 19:4636702-4636724 CGACCTGAGCTCCCAACTCAGGG + Intergenic
1162566213 19:11446901-11446923 GGGCCTGTGCTGCCCCCTCCTGG + Intronic
1165004183 19:32790906-32790928 TCTCCTGTGCTGACGCCTCAGGG + Intronic
1165892477 19:39122224-39122246 TGCCCTCTGCTGCCTCCTCATGG - Intergenic
1165943102 19:39425056-39425078 GGTCCTCTGCTCCCACGTCACGG + Exonic
1166072597 19:40395678-40395700 TGACCCCTGCTGCCACCTCAGGG + Exonic
1167359649 19:49023395-49023417 GGGCAGGTGCTGCCACCTCAGGG - Intronic
1167361482 19:49032690-49032712 GGGCAGGTGCTGCCACCTCAGGG + Intronic
1167362172 19:49036095-49036117 GGGCAGGTGCTGCCACCTCAGGG - Intronic
1167363912 19:49044763-49044785 GGGCAGGTGCTGCCACCTCAGGG + Intronic
1167364586 19:49048164-49048186 GGGCAGGTGCTGCCACCTCAGGG - Intronic
1167365871 19:49054800-49054822 GGGCAGGTGCTGCCACCTCAGGG - Intronic
1168029811 19:53670472-53670494 CATTCTGTTCTACCACCTCACGG - Intergenic
925032676 2:662951-662973 CGTCCTGTGCTGCTCACTCCAGG - Intergenic
925593941 2:5536861-5536883 CGTCCTGTGCTCCTAACTCCAGG + Intergenic
926247623 2:11132781-11132803 AGTCCTGTGCTGCCCCCTCGTGG - Intergenic
927520102 2:23693375-23693397 CCTCCTGGGCGGCCACCTCGGGG - Exonic
928177688 2:29046265-29046287 CTTTCTGTGTTGCCACCTCAAGG - Intronic
929058149 2:37896514-37896536 CTTCCTGTGGTGCCATCTCCAGG - Intergenic
930261789 2:49155219-49155241 AGTGCTGGGCTGTCACCTCAGGG - Intergenic
932620170 2:73260470-73260492 AGACCTCTGCTGCCACCTCCTGG + Exonic
935289561 2:101598598-101598620 CTTTCTGTGCTACCTCCTCAAGG + Intergenic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
937106493 2:119319839-119319861 CATCCGGGACTGCCACCTCACGG - Intronic
937993669 2:127677873-127677895 ACCCCTGTCCTGCCACCTCAGGG - Intronic
938389429 2:130893330-130893352 CGTCCTGTGCTGCTGTCTCTGGG + Intronic
944844471 2:203655097-203655119 CCCACTGTGCTGCCTCCTCAGGG - Intergenic
945331800 2:208548473-208548495 CCTCCTGTGATGCAACCTCCTGG - Intronic
948520404 2:238533052-238533074 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948520459 2:238533471-238533493 GGTGCAGTGCTTCCACCTCAGGG + Intergenic
948520987 2:238537701-238537723 GGTGCAGTGCTGCCACCTCAGGG + Intergenic
948521075 2:238538307-238538329 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521250 2:238539638-238539660 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521283 2:238539929-238539951 GGTCCAGTGCTCACACCTCAGGG + Intergenic
948521374 2:238540638-238540660 GGTGCAGTGCTTCCACCTCAGGG + Intergenic
948521508 2:238541636-238541658 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948521627 2:238542581-238542603 GGTGCAGTGCTACCACCTCAGGG + Intergenic
948521762 2:238543659-238543681 GGTGAAGTGCTGCCACCTCAGGG + Intergenic
948522143 2:238546602-238546624 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522323 2:238547844-238547866 AGTGCAGTGCTCCCACCTCAGGG + Intergenic
948522632 2:238550119-238550141 GGTGCAGTGCTCCCACCTCAGGG + Intergenic
948723227 2:239916711-239916733 CACCTTGTGCTGCCACCTCTGGG + Intronic
1170799952 20:19582848-19582870 CGGCCAGGCCTGCCACCTCATGG - Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172447543 20:35001092-35001114 CGGCCTGTTCTGCCTCCTCAAGG - Exonic
1172744142 20:37193707-37193729 CTTCCTGTGTTGCTATCTCATGG - Intronic
1173483598 20:43423448-43423470 CGACATGTGCAGCTACCTCATGG - Intergenic
1173856502 20:46253588-46253610 TGCTCTGTGCTGCCACCTCCAGG + Intronic
1174086974 20:48016373-48016395 CCTCCTGTGTTGCAACCACAAGG - Intergenic
1175690137 20:61059191-61059213 CCTCCTGAGCATCCACCTCATGG + Intergenic
1175874161 20:62221570-62221592 ATTCCTCTGCTGCCACCTCAGGG + Intergenic
1175888345 20:62304698-62304720 CGGCCTGAGATGCCACCTCAGGG + Intronic
1176429932 21:6569318-6569340 AGTCCTCTGCTGCCACCTGGTGG - Intergenic
1179705326 21:43176780-43176802 AGTCCTCTGCTGCCACCTGGTGG - Intergenic
1180094922 21:45551991-45552013 CTTCCTGTGCGGCCTCCTTATGG + Intergenic
1180129918 21:45820732-45820754 GGACCTCTGCTGCCACCTCGTGG + Intronic
1182453038 22:30432524-30432546 CCTCCTGTTCTTCCTCCTCATGG + Intergenic
1183287760 22:36978225-36978247 CGGCTTGTGCTGCCACCTACAGG + Intergenic
1183606418 22:38869029-38869051 CTTCATGTGCTGCCACCTAGTGG - Intronic
1183616930 22:38951161-38951183 CTTCCTGCCCTGGCACCTCATGG - Intergenic
1184040689 22:41941443-41941465 TGGCCTGGCCTGCCACCTCATGG + Intronic
1185047688 22:48537230-48537252 AGGCCGGTGCTGCCACCACATGG + Intronic
952240831 3:31530300-31530322 CTTCCAGTGCTGCTTCCTCAGGG + Intergenic
953982156 3:47418320-47418342 TGTGCTGCGCGGCCACCTCATGG - Exonic
954560220 3:51550175-51550197 GCTCCTGTGCTGCCTCCTAAGGG + Intronic
954976127 3:54696691-54696713 TGTCCTGTGGTTCCACTTCATGG + Intronic
955667163 3:61362733-61362755 AGTCCTGTGGTGCCATCTCTGGG - Intergenic
960461920 3:117946338-117946360 GTTCCTGTGCAGCTACCTCATGG + Intergenic
960706334 3:120485475-120485497 CATCCTCTGTGGCCACCTCATGG - Intergenic
961047962 3:123722279-123722301 CTTCCTGTGCTTCCTCCACAGGG - Exonic
961348163 3:126278369-126278391 GGCCTTGTGCTTCCACCTCACGG - Intergenic
965783305 3:172310715-172310737 AGTCCTGTGCTCTCCCCTCAGGG - Intronic
967159738 3:186725095-186725117 CGTACTGGGCTGTCACCACAGGG - Exonic
967197715 3:187043117-187043139 GGCCCTGCGCTGCCACCTCCGGG + Exonic
968704728 4:2072619-2072641 CATCCTGTGCTTGCCCCTCAGGG + Intronic
969779018 4:9381439-9381461 CGTCCTGTGCTGCCACCTCATGG - Intergenic
978587700 4:110291819-110291841 CAACCTGTCCTGCCACCTGAAGG + Intergenic
980165256 4:129218538-129218560 CGTACTTTGCTGCCATCTCCAGG - Intergenic
985785484 5:1891425-1891447 AGTCCTGTCCTGCCACAGCACGG + Intergenic
986132266 5:4942452-4942474 GGTGCTGTGCTGCCACCTAGGGG + Intergenic
986192695 5:5511609-5511631 CGTCCTGGGCTGACCCCACAAGG - Intergenic
986827036 5:11533045-11533067 CCCCCTGGGCTGCCACTTCATGG - Intronic
987669634 5:20990343-20990365 TCTGCTGTGCTGCCATCTCAGGG - Intergenic
994899017 5:105745951-105745973 AGTACTGAGCTGCTACCTCATGG - Intergenic
998339550 5:141404875-141404897 GGTCCTGTACAGCCACCACAAGG - Exonic
999257587 5:150218316-150218338 GCTCCTGTGCTGCCACCTGCTGG + Intronic
1004171872 6:13301524-13301546 ACTCCTGTGCTGCCACACCAGGG - Intronic
1006053967 6:31367024-31367046 CGTCCTGGGCATCCACCTCCAGG + Intergenic
1006298309 6:33179751-33179773 CCTCCTGGGCCGCCACCACAGGG + Exonic
1006513701 6:34534704-34534726 CGTCCTGAGCAGCCACCTCCAGG + Exonic
1007433883 6:41794139-41794161 TGTCCAGTGCTGCCGCCTCTGGG + Exonic
1011702680 6:89970226-89970248 AGTGCTGTCCTGCCACCTCAAGG + Intronic
1012417530 6:99026026-99026048 CAACCTGTGTTGCCACCACATGG + Intergenic
1017707130 6:157133610-157133632 CGTCCTGAGCCGTCAGCTCAGGG - Intronic
1018378139 6:163232741-163232763 CTTCCTGCTCTGGCACCTCAGGG - Intronic
1019617806 7:1974162-1974184 GGGCCTGTGCTGCCAGCTCCTGG - Intronic
1024896647 7:54268687-54268709 AGTCCTGTGCTGTCACATCAAGG - Intergenic
1025023198 7:55495965-55495987 CGTCGTGTGCTGCCTCGCCAAGG + Intronic
1026414396 7:70163114-70163136 AGTGGTGTGCAGCCACCTCATGG + Intronic
1029080804 7:97972396-97972418 CGTCCTCTTCTGGCACCCCAGGG + Intergenic
1029618945 7:101677970-101677992 CCTCTTGTGCTTCCACATCACGG - Intergenic
1034296928 7:149981873-149981895 TGTTCTGTGCTGCTGCCTCATGG - Intergenic
1036276457 8:7355398-7355420 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1037984816 8:23283544-23283566 CCTCCTCTAATGCCACCTCAAGG + Intronic
1038402804 8:27298310-27298332 GGTCCTGTGCAGCCACGTCCTGG - Intronic
1039737357 8:40347095-40347117 CTTTCTCTGCTGCCTCCTCAGGG + Intergenic
1040723138 8:50350133-50350155 GGTCCTTAGCTGCCTCCTCAGGG + Intronic
1044679393 8:94762364-94762386 GGTCCTGTGATCTCACCTCAAGG - Intronic
1044898163 8:96915175-96915197 CTTCCTGTCCTGCTACTTCAGGG + Intronic
1047033952 8:120914245-120914267 CATCCTCTGCCCCCACCTCATGG - Intergenic
1053073979 9:35117003-35117025 TGTCCTGTGCTGCCATCTACCGG - Intergenic
1053509850 9:38678362-38678384 CATCATGTGCTGCCCCCTCTCGG + Intergenic
1056565810 9:87771514-87771536 AGTCCTCTGCGGCCGCCTCAAGG - Intergenic
1057170898 9:92962447-92962469 GGTCCAGGGCTGCCTCCTCAGGG + Intronic
1057783858 9:98072228-98072250 GGCCCTGTGCTGGCACCCCACGG - Intronic
1060002972 9:119975296-119975318 CATGTTGTGCTCCCACCTCAAGG - Intergenic
1060297175 9:122350741-122350763 CGGCCTATGCTGCCACCTGGTGG + Intergenic
1060933903 9:127505123-127505145 CTGCCTGTGCTGCCACCAGAAGG + Intergenic
1061479048 9:130887520-130887542 CGTCCTGCCCTGCCCCCTCGGGG + Intronic
1062194657 9:135266278-135266300 CCTCCTGGGCTGCCTCCTCCTGG + Intergenic
1185561292 X:1062370-1062392 CCTACTGTGTTGCCACCTCCAGG + Intergenic
1185808478 X:3081958-3081980 CTTCCTGTCCTGCAACCCCACGG - Intronic
1187268295 X:17757130-17757152 TGTCCTGTGCAGCCACCAGAAGG - Intergenic
1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG + Intergenic
1195004328 X:100671325-100671347 TGCCCTCTGCTGTCACCTCAGGG - Intergenic
1196103266 X:111869751-111869773 CACCCTCTGCTGCCATCTCATGG - Intronic
1200102462 X:153694847-153694869 CCTCCTGGGCTGCCTCCTCAGGG + Exonic