ID: 1036840475

View in Genome Browser
Species Human (GRCh38)
Location 8:12116956-12116978
Sequence AGTCTTTTCTGGGCCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036840467_1036840475 23 Left 1036840467 8:12116910-12116932 CCTGGAGTAGGTAGGTTGCCAAG No data
Right 1036840475 8:12116956-12116978 AGTCTTTTCTGGGCCAACAAGGG No data
1036840470_1036840475 -6 Left 1036840470 8:12116939-12116961 CCTCATATGGTAGCACCAGTCTT No data
Right 1036840475 8:12116956-12116978 AGTCTTTTCTGGGCCAACAAGGG No data
1036840469_1036840475 5 Left 1036840469 8:12116928-12116950 CCAAGTCTGTGCCTCATATGGTA No data
Right 1036840475 8:12116956-12116978 AGTCTTTTCTGGGCCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036840475 Original CRISPR AGTCTTTTCTGGGCCAACAA GGG Intergenic
No off target data available for this crispr