ID: 1036849865

View in Genome Browser
Species Human (GRCh38)
Location 8:12194047-12194069
Sequence TGGCGCCCGAGGAGAACGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 6, 1: 4, 2: 0, 3: 3, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036849865_1036849881 27 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849881 8:12194097-12194119 CGGGAGACCTGGAGGAAGCCGGG 0: 2
1: 1
2: 6
3: 21
4: 355
1036849865_1036849873 7 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849873 8:12194077-12194099 GGCGAGGCCGCAGCCGTTGCCGG 0: 2
1: 0
2: 0
3: 10
4: 125
1036849865_1036849876 16 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849876 8:12194086-12194108 GCAGCCGTTGCCGGGAGACCTGG 0: 2
1: 0
2: 1
3: 13
4: 124
1036849865_1036849874 8 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849874 8:12194078-12194100 GCGAGGCCGCAGCCGTTGCCGGG 0: 2
1: 0
2: 1
3: 3
4: 126
1036849865_1036849877 19 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849877 8:12194089-12194111 GCCGTTGCCGGGAGACCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 117
1036849865_1036849880 26 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849880 8:12194096-12194118 CCGGGAGACCTGGAGGAAGCCGG 0: 3
1: 1
2: 3
3: 44
4: 360
1036849865_1036849871 -9 Left 1036849865 8:12194047-12194069 CCCCGCGTTCTCCTCGGGCGCCA 0: 6
1: 4
2: 0
3: 3
4: 48
Right 1036849871 8:12194061-12194083 CGGGCGCCATAACGTGGGCGAGG 0: 2
1: 5
2: 2
3: 3
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036849865 Original CRISPR TGGCGCCCGAGGAGAACGCG GGG (reversed) Exonic