ID: 1036851627

View in Genome Browser
Species Human (GRCh38)
Location 8:12205914-12205936
Sequence TGGGATGCCCCTGCCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036851627_1036851632 13 Left 1036851627 8:12205914-12205936 CCAACTTGGGCAGGGGCATCCCA No data
Right 1036851632 8:12205950-12205972 GCACAATATCAAACTTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036851627 Original CRISPR TGGGATGCCCCTGCCCAAGT TGG (reversed) Intergenic
No off target data available for this crispr