ID: 1036860592

View in Genome Browser
Species Human (GRCh38)
Location 8:12345151-12345173
Sequence GTCTTGTAGAATTTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036860592_1036860595 -1 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860595 8:12345173-12345195 CTAGATGCTGAGAAGGAAGAGGG 0: 6
1: 0
2: 7
3: 36
4: 515
1036860592_1036860601 29 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860601 8:12345203-12345225 GGGATGGAGATGGAGCCTTAAGG 0: 6
1: 0
2: 1
3: 38
4: 401
1036860592_1036860602 30 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860602 8:12345204-12345226 GGATGGAGATGGAGCCTTAAGGG 0: 6
1: 0
2: 1
3: 17
4: 260
1036860592_1036860596 8 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860596 8:12345182-12345204 GAGAAGGAAGAGGGAAAGCCAGG No data
1036860592_1036860599 19 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860599 8:12345193-12345215 GGGAAAGCCAGGGATGGAGATGG No data
1036860592_1036860598 13 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860598 8:12345187-12345209 GGAAGAGGGAAAGCCAGGGATGG No data
1036860592_1036860594 -2 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860594 8:12345172-12345194 ACTAGATGCTGAGAAGGAAGAGG 0: 6
1: 0
2: 9
3: 76
4: 675
1036860592_1036860597 9 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860597 8:12345183-12345205 AGAAGGAAGAGGGAAAGCCAGGG No data
1036860592_1036860593 -8 Left 1036860592 8:12345151-12345173 CCTGTGTTTAAATTCTACAAGAC No data
Right 1036860593 8:12345166-12345188 TACAAGACTAGATGCTGAGAAGG 0: 6
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036860592 Original CRISPR GTCTTGTAGAATTTAAACAC AGG (reversed) Intergenic
No off target data available for this crispr