ID: 1036862011

View in Genome Browser
Species Human (GRCh38)
Location 8:12361951-12361973
Sequence CGTCCTGTGCTGCCACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036862005_1036862011 27 Left 1036862005 8:12361901-12361923 CCACACCTGAATTTCAGTGATTC No data
Right 1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG No data
1036862008_1036862011 -6 Left 1036862008 8:12361934-12361956 CCACCGCTAAGACCAAACGTCCT No data
Right 1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG No data
1036862009_1036862011 -9 Left 1036862009 8:12361937-12361959 CCGCTAAGACCAAACGTCCTGTG No data
Right 1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG No data
1036862006_1036862011 22 Left 1036862006 8:12361906-12361928 CCTGAATTTCAGTGATTCAGACT No data
Right 1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036862011 Original CRISPR CGTCCTGTGCTGCCACCTCA TGG Intergenic
No off target data available for this crispr