ID: 1036862273

View in Genome Browser
Species Human (GRCh38)
Location 8:12363201-12363223
Sequence AGTCTTTTCTGGGCCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036862265_1036862273 23 Left 1036862265 8:12363155-12363177 CCTGGAGTAGGTAGGTTGCCAAG No data
Right 1036862273 8:12363201-12363223 AGTCTTTTCTGGGCCAACAAGGG No data
1036862268_1036862273 -6 Left 1036862268 8:12363184-12363206 CCTCATATGGTAGCACCAGTCTT No data
Right 1036862273 8:12363201-12363223 AGTCTTTTCTGGGCCAACAAGGG No data
1036862267_1036862273 5 Left 1036862267 8:12363173-12363195 CCAAGTCTGTGCCTCATATGGTA No data
Right 1036862273 8:12363201-12363223 AGTCTTTTCTGGGCCAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036862273 Original CRISPR AGTCTTTTCTGGGCCAACAA GGG Intergenic
No off target data available for this crispr