ID: 1036870733

View in Genome Browser
Species Human (GRCh38)
Location 8:12433313-12433335
Sequence TGGAAAAGATGCAGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036870733_1036870740 24 Left 1036870733 8:12433313-12433335 CCTGCTGTGCTGCATCTTTTCCA 0: 1
1: 0
2: 2
3: 32
4: 294
Right 1036870740 8:12433360-12433382 AGCACAGGAATTCTTCACCGGGG No data
1036870733_1036870735 -8 Left 1036870733 8:12433313-12433335 CCTGCTGTGCTGCATCTTTTCCA 0: 1
1: 0
2: 2
3: 32
4: 294
Right 1036870735 8:12433328-12433350 CTTTTCCACGTGGATAATCTTGG No data
1036870733_1036870737 9 Left 1036870733 8:12433313-12433335 CCTGCTGTGCTGCATCTTTTCCA 0: 1
1: 0
2: 2
3: 32
4: 294
Right 1036870737 8:12433345-12433367 TCTTGGTTCATCTCTAGCACAGG No data
1036870733_1036870739 23 Left 1036870733 8:12433313-12433335 CCTGCTGTGCTGCATCTTTTCCA 0: 1
1: 0
2: 2
3: 32
4: 294
Right 1036870739 8:12433359-12433381 TAGCACAGGAATTCTTCACCGGG No data
1036870733_1036870738 22 Left 1036870733 8:12433313-12433335 CCTGCTGTGCTGCATCTTTTCCA 0: 1
1: 0
2: 2
3: 32
4: 294
Right 1036870738 8:12433358-12433380 CTAGCACAGGAATTCTTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036870733 Original CRISPR TGGAAAAGATGCAGCACAGC AGG (reversed) Intronic
900597102 1:3485213-3485235 TGCAAAAGATGCCGCCCAGCGGG - Intergenic
900902759 1:5528004-5528026 TGGCACTGGTGCAGCACAGCCGG - Intergenic
901290186 1:8118054-8118076 TGCAAAAGATGCAGCCAGGCGGG - Intergenic
901782340 1:11602324-11602346 TGGAAGAGGGGCAGCTCAGCCGG + Intergenic
901856534 1:12047872-12047894 TGGAAAAGGGGCAACACAGCTGG - Intergenic
901987812 1:13090168-13090190 TGAGAAAGAAGCAGGACAGCTGG - Intergenic
901994000 1:13136599-13136621 TGAGAAAGAAGCAGGACAGCTGG + Intergenic
902006581 1:13237030-13237052 AGGAAATGATTCAGAACAGCTGG - Intergenic
902025636 1:13381421-13381443 AGGAAATGATTCAGAACAGCTGG - Intergenic
902673141 1:17989314-17989336 TGGAGAAGATGCAGAGCAACTGG - Intergenic
903697119 1:25215966-25215988 TGGAACAGAAGCAGCACTTCAGG - Intergenic
904133883 1:28296044-28296066 TGGCAAAGATGCAGAGCAACTGG - Intergenic
904271304 1:29351993-29352015 TGGAGAATATGCTGCACACCAGG + Intergenic
904363040 1:29990841-29990863 TGGAAAAGATGCATCAGAAAAGG - Intergenic
906952576 1:50346888-50346910 GGGAGAGGAGGCAGCACAGCCGG + Intergenic
907023422 1:51091004-51091026 TGGAAACTATGCAGGACAGTAGG + Intergenic
907638560 1:56161149-56161171 TGGAAAACTGGCAGCAAAGCTGG + Intergenic
908471713 1:64450720-64450742 TAGAAAAGCTGCAGCTAAGCAGG + Intergenic
908599806 1:65726416-65726438 TTCAAAAGATGGAGCACAGAAGG + Intergenic
908679340 1:66642190-66642212 TGGAGAAGAAGCTGCACAGCGGG - Intronic
909484471 1:76158027-76158049 TGGAAAATAGGCAGCATAGTGGG - Intronic
912309957 1:108610211-108610233 TGGAAACGATCCAGCAGAGAAGG + Intronic
915740609 1:158115896-158115918 TGGAGGAGATTCAGCACAGGAGG - Intergenic
915862752 1:159464237-159464259 TGGCAAGGATGCAGAACAACTGG - Intergenic
916337467 1:163689604-163689626 TGGTGAGGATGCAGAACAGCAGG + Intergenic
916364600 1:164010606-164010628 TGGAAAAGATGCAGAATACAAGG + Intergenic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
916741957 1:167653972-167653994 TGACAAAGCTGCAGCAGAGCTGG - Intronic
917552973 1:176054727-176054749 TGGAAAAGATCCAGGATAGATGG - Intronic
919316053 1:195971369-195971391 TGGAAAAGACGCAGAAAGGCAGG + Intergenic
919991792 1:202712338-202712360 TGGAAAAGTTGAAGCGCATCAGG - Intergenic
920797089 1:209149635-209149657 TAGAACAGATGCATAACAGCTGG + Intergenic
921171692 1:212555610-212555632 TTGAGAGGATACAGCACAGCAGG - Intergenic
921264341 1:213410205-213410227 TGGAAAAGAGGCAGCAGAAAGGG + Intergenic
921282503 1:213581227-213581249 TGGAAGAGATGCAGCCTCGCCGG + Intergenic
921752818 1:218817247-218817269 TGGAAAAGAGACAGCACAACAGG + Intergenic
922623836 1:227016926-227016948 AGGAAAGGATGCAGCAGAGGAGG - Exonic
923463688 1:234230196-234230218 TAAAACAGATACAGCACAGCTGG + Intronic
924225974 1:241921923-241921945 TGGAAAAGAGACAGCAGAGACGG + Intergenic
1064406583 10:15069568-15069590 TGGAAAAGAGGCTGCATGGCTGG + Intronic
1064955984 10:20910609-20910631 TGGAAAGCATGCAACACAGAAGG + Intronic
1067325451 10:45261496-45261518 TGAAAATGAAGCAGCACAGGGGG + Intergenic
1067347861 10:45450619-45450641 GTGAAAAGAAGCTGCACAGCTGG + Intergenic
1068525389 10:58123203-58123225 TGGACAAGATGCAAAACAGATGG + Intergenic
1070364112 10:75719377-75719399 TGGTTAAGATGGAGAACAGCTGG - Intronic
1070897200 10:79995099-79995121 TTAAAAAGAACCAGCACAGCCGG - Intergenic
1071029660 10:81161549-81161571 TGGAAAAAGTGCAGCAAATCAGG + Intergenic
1072930859 10:99660461-99660483 GGGGAAAGATGCAGAACAGCAGG + Intronic
1075393835 10:122113014-122113036 GGGAAAAGTTGCAGCACAAAAGG - Intronic
1075482925 10:122797900-122797922 TGGAAAAGATGCTGCAAAAGGGG - Intergenic
1075988389 10:126809505-126809527 TGGAAAGGATGCAGAGCAACTGG + Intergenic
1076321529 10:129585770-129585792 AGGAAAAGATACTGCACAGCCGG - Intronic
1076513412 10:131028281-131028303 TGGAAAAGTTCCAGCAGAGGTGG - Intergenic
1077821854 11:5753249-5753271 TGGCAAAGATGTAGAACAACTGG - Intronic
1078355256 11:10627934-10627956 TGGCATAGAAACAGCACAGCAGG + Intronic
1078871102 11:15345906-15345928 TGAATAAAATGTAGCACAGCAGG + Intergenic
1079887721 11:26008642-26008664 TGGAAAAGATGCAGAGAACCTGG - Intergenic
1083407070 11:62464882-62464904 TGTAAAAGTTGCAGAACACCTGG + Intronic
1083930903 11:65844494-65844516 TGGCAAAGATGTAGTACAACTGG + Intronic
1084336052 11:68458595-68458617 TAGAAAAGATCCAGTACAGCTGG + Intergenic
1084949369 11:72656301-72656323 TGGATAAGTTCCAGCACAGCAGG + Intronic
1086754227 11:90538719-90538741 TGGGGAGGATACAGCACAGCAGG - Intergenic
1087655639 11:100919438-100919460 CAGAAAAGATTTAGCACAGCAGG - Intronic
1087795760 11:102453298-102453320 TGGAGAAGATGAAGTACAACTGG - Intronic
1089397349 11:118145122-118145144 TGGAGAAGGTGCAGGGCAGCAGG + Exonic
1090732627 11:129585039-129585061 TGCCAAAGATGCAGCAGTGCTGG - Intergenic
1090904739 11:131065419-131065441 TGGACAAGATGAGGTACAGCAGG - Intergenic
1091214648 11:133893283-133893305 TGAACAAGAGGCGGCACAGCTGG + Intergenic
1091686224 12:2564755-2564777 TGGAAAAGATGACACAGAGCTGG - Intronic
1092851054 12:12627059-12627081 AGGAATAGATGGAGCACAGGGGG + Intronic
1093041614 12:14387644-14387666 TTGCAAAAATGCAACACAGCAGG - Intronic
1094246527 12:28302721-28302743 TGGAAAACATGAAGCAAAGCAGG + Intronic
1099828340 12:87808041-87808063 TGGAAAACATTCATCACAGCAGG - Intergenic
1100888922 12:99102358-99102380 GAGAAAATGTGCAGCACAGCTGG + Intronic
1101497202 12:105265947-105265969 TGGAAAGGATGTAGAACAACAGG + Intronic
1103158648 12:118708692-118708714 TGGAAATGAAGCAGCAAGGCAGG - Intergenic
1104160627 12:126176794-126176816 TGGAAAAGATGCAGAGCAACAGG - Intergenic
1104629792 12:130390876-130390898 TGGAGAAGAAGCTGCCCAGCAGG - Intergenic
1105046336 12:133006969-133006991 TGGAAAAGATGCAGAGGAACTGG - Intronic
1105564598 13:21531918-21531940 TGGCACAGAGGCAGCAAAGCTGG + Intronic
1105955915 13:25282527-25282549 TGGAAGAGGTGAAGCACAGATGG - Intronic
1106499468 13:30313570-30313592 TGAAAAAGGAGCAGTACAGCTGG + Intergenic
1106980773 13:35277111-35277133 TGGACAAGATTCAACAAAGCTGG + Intronic
1107890353 13:44908957-44908979 AGGAAGTGGTGCAGCACAGCTGG + Intergenic
1108071094 13:46629453-46629475 TTGAAAAGATGCAGAGCAGCTGG + Intronic
1108751837 13:53455790-53455812 TGGAAAATATTCAGCGCACCAGG - Intergenic
1109161169 13:58976507-58976529 TGTAAAAGAAGCAGCAGACCAGG + Intergenic
1109193296 13:59351114-59351136 TGGAAAATATCCAGAACAGTTGG - Intergenic
1110609544 13:77473841-77473863 TGGCAAAGAGGCTGAACAGCTGG + Intergenic
1111970039 13:94902472-94902494 TGGAAAAGATGAATTACAGAAGG - Intergenic
1112438490 13:99408376-99408398 TGGAAGCTGTGCAGCACAGCTGG - Intergenic
1114260369 14:21032219-21032241 GGGAGAAGAGGCAGCACAGGAGG + Intronic
1114771370 14:25431100-25431122 TGGAAAGGATGCAGCAGTGGAGG + Intergenic
1115870578 14:37797303-37797325 TGTAAAAGATGCAGACCAACAGG - Intronic
1116992504 14:51291262-51291284 TGGAAACCAGGCCGCACAGCAGG - Intergenic
1119475747 14:74926667-74926689 TGGAAAAGAAGCAGAGCAGAGGG - Intergenic
1119648138 14:76363443-76363465 TGGAGAAGATGAAGGGCAGCCGG - Intronic
1119908046 14:78323403-78323425 TGGGTAAGACGCAGCACACCTGG + Intronic
1119922405 14:78458525-78458547 TAGAAAAGATGGAACACAGGAGG - Intronic
1121933769 14:97997541-97997563 TGGGAAAGAGGAAACACAGCAGG - Intergenic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1122150469 14:99723039-99723061 TGGAGATGATGAAGAACAGCAGG - Intronic
1123481716 15:20638599-20638621 TAGAAACCAGGCAGCACAGCAGG - Intergenic
1123632859 15:22274076-22274098 TGGAAAAGAAACAGAACAGAGGG - Intergenic
1123636297 15:22361766-22361788 TAGAAACCAGGCAGCACAGCAGG + Intergenic
1124403268 15:29369391-29369413 TAGAAAACATGCAGGACAGGAGG + Intronic
1124462526 15:29905869-29905891 TGGAACAGGTGGAGCACAGAGGG + Intronic
1125015586 15:34931130-34931152 CCTAAAAGAAGCAGCACAGCCGG - Intronic
1126350754 15:47742698-47742720 TGGAATAGATGCAGCCCCTCAGG + Intronic
1126757163 15:51936037-51936059 AGGAAAAGCTGCTGCCCAGCTGG + Intronic
1127093623 15:55491158-55491180 AGCAAAAGCTGCAGCAAAGCGGG - Exonic
1127500057 15:59546792-59546814 TGGAAACCAGGCCGCACAGCAGG + Intergenic
1128997949 15:72310490-72310512 TGGAAAGGAAGCAACACTGCAGG - Intronic
1131789239 15:95946409-95946431 TGGAAAAGAGGAAGGGCAGCTGG + Intergenic
1133853135 16:9524749-9524771 TGGAAAGGATACAGGAAAGCAGG - Intergenic
1134421862 16:14099959-14099981 TAGAAAAGATGCAGAATGGCTGG - Intronic
1135081873 16:19443400-19443422 TGGAAAAGATACATCTGAGCAGG - Intronic
1138277897 16:55749644-55749666 TGGCAAAGACACAGCACAGCTGG + Intergenic
1138339537 16:56279572-56279594 TGGACAAGATGAAGCATAGTGGG - Intronic
1138770865 16:59661951-59661973 CAGAAATGATGCAGCACAACTGG + Intergenic
1141881773 16:86865027-86865049 TTGAAAACCTGCAGCACACCGGG + Intergenic
1141970202 16:87476689-87476711 TGGAAAAGAAACAGAACAGAGGG + Intronic
1143223916 17:5283860-5283882 TGGAACAGAAACAGCAAAGCAGG - Intronic
1143396590 17:6603996-6604018 TGACAAAGATGCAGCACAACTGG + Intronic
1143591122 17:7886161-7886183 TGGTCAAGCTGCAGAACAGCTGG - Intronic
1144651159 17:17008057-17008079 GGGCAGAGGTGCAGCACAGCTGG - Intergenic
1145048717 17:19641872-19641894 TGGCAAGGATGTGGCACAGCAGG + Intergenic
1146379246 17:32316453-32316475 TGGTTACGAAGCAGCACAGCAGG - Intronic
1147766943 17:42843358-42843380 GGGAAAAGATTCAGCTCAACTGG - Exonic
1147791297 17:43015764-43015786 TGGCACAAAAGCAGCACAGCAGG + Exonic
1149633821 17:58149858-58149880 TGGAGAAGAAGAAGCAGAGCTGG - Intergenic
1151367884 17:73628961-73628983 TGGGAGAGCTGCAGAACAGCTGG - Intronic
1152885820 17:82848812-82848834 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1152885898 17:82849240-82849262 TGGAGAAGACGCAGCAGAGCGGG - Intronic
1155618659 18:27750351-27750373 TGGAAAAGATGATGCACATTTGG - Intergenic
1157275480 18:46308253-46308275 TGGATGAGATGCAGCAGAGGTGG + Intergenic
1160464424 18:79064433-79064455 TGGAGTAGATGCAGGCCAGCTGG - Intergenic
1161687027 19:5707962-5707984 TGGAGAACAAGCAGCAGAGCTGG - Intronic
1162343852 19:10108332-10108354 TGGAAAAGGTGCAGCTCACGGGG - Intronic
1162723225 19:12674669-12674691 TGGACAGGATGGAGCCCAGCTGG + Intronic
1163527937 19:17832616-17832638 TGAAACAGCTGCAGCACAGCGGG - Exonic
1163574522 19:18102900-18102922 TGGAGAAGACATAGCACAGCAGG - Intronic
925365614 2:3309843-3309865 TGGGAGAGAGGCAGCAGAGCTGG + Intronic
925500315 2:4496536-4496558 TGATAAAGATGCAGAACAACAGG - Intergenic
925606164 2:5662515-5662537 AGGAAGAGATGGAGCACAGAAGG - Intergenic
925663265 2:6225010-6225032 TGGAAAAGAAGCAACACAGGAGG - Intergenic
926940337 2:18129278-18129300 TGAAAAACTTGAAGCACAGCAGG - Intronic
927186712 2:20487372-20487394 TGCAAAAGAGGCAGCACCGTTGG + Intergenic
928551246 2:32373075-32373097 TGGCAAGGATGCAGAACAACTGG - Intronic
928886464 2:36154400-36154422 TGGAACAGATGCAGCTGAGAAGG - Intergenic
931022974 2:58070945-58070967 TGGCAAGGATGCAGCACAACAGG - Intronic
931119662 2:59202006-59202028 TGAAAAAGATGCAGGAAAGAGGG + Intergenic
931228360 2:60352948-60352970 CGGACCAGGTGCAGCACAGCTGG + Intergenic
931659195 2:64542371-64542393 TGGAAAAGATTCATCACATGTGG - Intronic
932665741 2:73697339-73697361 TTGAGAGGATGCAGCACACCAGG - Intergenic
933125507 2:78599415-78599437 TTGAAGTGAAGCAGCACAGCAGG - Intergenic
935014407 2:99166586-99166608 TAGGAATGATGCAGTACAGCAGG + Intronic
935039508 2:99412326-99412348 TTGGAAAGCTGCAGCACAGATGG - Intronic
938402493 2:131005023-131005045 TGGAACAGCTGCAGCAAAGGGGG + Intronic
938422834 2:131157581-131157603 TGGAAAGAATGGAGCACAGGTGG - Intronic
938962975 2:136359628-136359650 TGGAAAAGATGAATCAAAGTAGG - Intergenic
939408159 2:141787099-141787121 TGGTAAAGATGCAAAACAACTGG + Intronic
939798504 2:146678473-146678495 TGCAAAGGGTGGAGCACAGCAGG - Intergenic
940721064 2:157282501-157282523 TTGAAATTATGAAGCACAGCTGG + Intronic
941263603 2:163330201-163330223 TGGCAAGGATGCAGAAAAGCTGG - Intergenic
941330066 2:164169173-164169195 TGGAAAAGTTGTAGTACAGGTGG - Intergenic
941549930 2:166902465-166902487 TGGAAAAGTATCAGCACAGTGGG - Intronic
941841811 2:170093329-170093351 TTGTAAAGATCCAGAACAGCTGG + Intergenic
942155496 2:173123281-173123303 TGGGAAATATACAGCACATCAGG - Intronic
942309000 2:174636577-174636599 TGGAACAGATAAAGGACAGCAGG - Intronic
942478402 2:176354134-176354156 TGGAGAAGATGCAGAAAAGGTGG - Intergenic
942682127 2:178487828-178487850 TGGCAAAGATGCAGAACAACTGG - Intronic
944881675 2:204019015-204019037 ATGGAAAGATTCAGCACAGCAGG + Intergenic
945033403 2:205685192-205685214 TGGAAGTGACGCAGCACTGCTGG - Intronic
948441633 2:237994720-237994742 TGCAAAAGAAACAGCACATCAGG - Intronic
1168793668 20:596855-596877 TGGCACAGAGGCAGCAGAGCAGG + Intergenic
1170105415 20:12750246-12750268 TGGAAATGATGCAGAAGGGCTGG + Intergenic
1170117445 20:12875643-12875665 TGGAATAAATGCAGCAAAGGAGG - Intergenic
1172975202 20:38900872-38900894 TGGAAAACATGCTGCGCAGAAGG + Intronic
1174079459 20:47960755-47960777 TGGTGGAGGTGCAGCACAGCTGG - Intergenic
1176111396 20:63412453-63412475 TGGGAAAGAGGCCTCACAGCTGG + Intronic
1177361836 21:20083424-20083446 TGGGAAACATTCAGCACACCTGG - Intergenic
1177732419 21:25044887-25044909 TGGAAAAGAATCAGCATAGAAGG + Intergenic
1179096696 21:38322533-38322555 TGGAAGAAATGCACCACAGAGGG + Intergenic
1180756031 22:18161855-18161877 TGGAGAAGATGCAGGACAGCCGG + Exonic
1181075737 22:20375548-20375570 TGGAGAAGATGCAGGACAGCCGG - Exonic
1181949331 22:26542759-26542781 AGGAAAGGATGCAGCACGACTGG + Intronic
1182888749 22:33798545-33798567 TGGTAAAGATGGAGAAAAGCAGG - Intronic
1183766364 22:39879633-39879655 TGGTAAAGATGCAGAGCATCAGG + Intronic
949216633 3:1577528-1577550 TGGAAAAGATGCAACAGCTCAGG + Intergenic
949824350 3:8149388-8149410 TGGAAAATATGCACCATATCAGG + Intergenic
949887502 3:8708074-8708096 TGGCAAGGTTGCAGCAAAGCTGG + Intronic
950385448 3:12655431-12655453 TGGAAAAGATGTGGCAAAACTGG + Intronic
951378156 3:21949362-21949384 TGGAAAAGGCACAGCACATCAGG - Intronic
952924930 3:38313832-38313854 GGAGAAAGATGCAGCACAGCCGG - Exonic
954006425 3:47594870-47594892 GGGATATGCTGCAGCACAGCAGG + Intronic
954223437 3:49168087-49168109 TGGAAGGGACACAGCACAGCCGG - Intergenic
954700312 3:52447440-52447462 TGGAAAGGATGCAGCAAAACAGG + Intergenic
958959181 3:100492609-100492631 GGGAACAGATGAAGCACATCTGG + Exonic
958962474 3:100523134-100523156 TGCAGAAGATGTAGCAAAGCTGG - Intronic
959384946 3:105692509-105692531 AGGAAAAGGTGAAGCACAGGAGG + Intronic
961615282 3:128174536-128174558 TGGAGAAGCTGCAGCACAACAGG + Intronic
963288281 3:143459785-143459807 TAGAAAATATGCAGCACTGTGGG - Intronic
963900904 3:150732779-150732801 GGGTATAGATGCAGGACAGCTGG + Intergenic
964723028 3:159786776-159786798 TAGAAATGAAGCATCACAGCTGG + Intronic
966030037 3:175334772-175334794 TGGAAAACAGGGAGCACAGCAGG + Intronic
966350067 3:179024075-179024097 TGGAAAACCCACAGCACAGCTGG + Exonic
967067737 3:185935516-185935538 TGGAAAAGGTGGGGCACAGAGGG + Intronic
967198302 3:187048797-187048819 TGGAGAACATCCAGCACAGAAGG - Intronic
967350838 3:188511980-188512002 TGGAAAAGATGTTTCACAGTGGG + Intronic
967573963 3:191068176-191068198 TGGAATTGATGCAGCAGAGTTGG - Intergenic
968160456 3:196422519-196422541 TGGAAAGAATGCAGAACAACTGG + Intronic
969047329 4:4345931-4345953 TGGCTGAGATGCAGCAGAGCTGG - Intergenic
969937447 4:10696328-10696350 TGGAGCAGATGCAGCAAAGGGGG - Intergenic
972397859 4:38672808-38672830 TGGAAAAGCTGCAGCAATGCAGG + Intronic
972643039 4:40942837-40942859 TGGGAAGAATGCAGCACAGGTGG - Intronic
972712655 4:41613269-41613291 TGGGAAAGTTGCAGCAAAGGAGG + Intronic
975206401 4:71648581-71648603 GGGAAATGATGCAACACAGTTGG - Intergenic
975968715 4:80007679-80007701 TTGAAAAGATGCAACACATCTGG + Intronic
976567861 4:86572783-86572805 TGGTAAAGATGCAAATCAGCGGG - Intronic
977254419 4:94725192-94725214 TGGATGAGATGCTGCACAGAGGG + Intergenic
977419278 4:96777076-96777098 TTGAAAAGAGGCAGCAAAGGCGG + Intergenic
978660114 4:111115984-111116006 TGGATAAGATGCTGCTCAACTGG + Intergenic
982508907 4:156255316-156255338 TGGAAAATCTGAAGCACAGATGG - Intergenic
982812625 4:159845187-159845209 TGGCAAAGACACAGAACAGCTGG - Intergenic
983113168 4:163779342-163779364 TGGAAAAGCTTCATCCCAGCTGG + Intronic
983332776 4:166352832-166352854 AGGTAAAGATACAGTACAGCAGG + Intergenic
988390781 5:30627112-30627134 TGGAATAGAAGAAGAACAGCTGG - Intergenic
991369140 5:65900105-65900127 TGGAAAAGCTGGAACACAGAAGG + Intergenic
995019284 5:107348626-107348648 TGGAGAAGATAAAGAACAGCTGG + Intergenic
995177901 5:109199544-109199566 TGACAGCGATGCAGCACAGCGGG + Intergenic
995323618 5:110865716-110865738 AGGATGAGATTCAGCACAGCTGG + Intergenic
996813764 5:127550508-127550530 TGGCAAAAATCCAGAACAGCTGG - Intronic
999858169 5:155617718-155617740 TGGAAAAATTGGGGCACAGCAGG + Intergenic
1000193890 5:158939489-158939511 TGGAAAATCTCCAGCACACCTGG + Intronic
1000370675 5:160533140-160533162 TAGACAAGATGCAGCACAAGTGG - Intergenic
1001929120 5:175660110-175660132 TGGCAGAGATGGACCACAGCTGG - Intronic
1003137354 6:3443979-3444001 TTGGAAAGATGCAGGGCAGCAGG - Intronic
1004115409 6:12761932-12761954 TGGAAGAAATGCAGGGCAGCTGG - Intronic
1004638495 6:17491197-17491219 TGGAAAAGGTGGAGAACAGATGG - Intronic
1005042863 6:21615131-21615153 GGAACAAGATGCAGGACAGCTGG + Intergenic
1006319332 6:33311014-33311036 TTGAAAAGAAAGAGCACAGCAGG + Intronic
1008537511 6:52518058-52518080 TGGAAAACATACAGTGCAGCAGG + Intronic
1008892772 6:56513941-56513963 TGGAGAAGATGCTGTAGAGCTGG + Intronic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1013041642 6:106440123-106440145 AAGAAGAGAGGCAGCACAGCAGG - Intergenic
1014408167 6:121077926-121077948 TGGAAATGATGCAGTAGAGAAGG - Intergenic
1014478947 6:121911597-121911619 TGGACAGCATGTAGCACAGCTGG - Intergenic
1015109958 6:129581334-129581356 TGGATCAGATGCAGTGCAGCAGG - Intronic
1016012305 6:139149976-139149998 TGTAAATCATGCAGCACAACAGG - Intronic
1016314508 6:142771347-142771369 TGAAGAGGAGGCAGCACAGCAGG + Exonic
1016545993 6:145224957-145224979 TGAAAAAGATCCAGAACTGCTGG - Intergenic
1016760726 6:147733705-147733727 TAGAAAACATGAATCACAGCGGG - Intronic
1017305726 6:152916337-152916359 AGGAGAAGATGTAGTACAGCAGG - Intergenic
1017953722 6:159160673-159160695 TGGAAAATATGCAAGAAAGCAGG + Intergenic
1018567951 6:165177009-165177031 TGGAAAACACGCAGCTCAGCTGG + Intergenic
1018950034 6:168373010-168373032 TGGATAAGCTGGGGCACAGCAGG + Intergenic
1023727627 7:43160864-43160886 TGTAAAAGGCACAGCACAGCGGG - Intronic
1023861302 7:44218972-44218994 GGGAAAGGAGGCAGCCCAGCGGG + Exonic
1023966510 7:44965664-44965686 TGGAAGGGCTGCAGCACAGCAGG + Exonic
1024365579 7:48516749-48516771 TGGAAAAGATTCTGGACATCAGG - Exonic
1025062740 7:55824856-55824878 TGGCAAAGATACAGAGCAGCAGG + Intronic
1027875904 7:83767732-83767754 TGGAAAAACTGAAGCACAGAAGG + Intergenic
1028733366 7:94178910-94178932 TGGAAAGGAGGCAGAAGAGCTGG - Intergenic
1029142189 7:98419186-98419208 TGGAAAAGGTGAAGGACACCAGG + Intergenic
1030088961 7:105840574-105840596 TGGAGAAGATACAACAGAGCTGG - Intronic
1030575225 7:111277604-111277626 TGGCAAAGATGCAGCAGAAAAGG + Intronic
1030890124 7:114989488-114989510 TGGAAAAGATCCAGGAGAGAAGG + Intronic
1031223966 7:119010778-119010800 TGGAAACCAGGCTGCACAGCAGG - Intergenic
1032300698 7:130683674-130683696 TGAAAAAGAGGCAGAACATCCGG + Intronic
1033021387 7:137728524-137728546 GGGAAAAGATGAAGGAAAGCTGG + Intronic
1034557065 7:151856863-151856885 AGGAGAAGATACAGGACAGCAGG + Intronic
1036870733 8:12433313-12433335 TGGAAAAGATGCAGCACAGCAGG - Intronic
1038416134 8:27397366-27397388 TGGGAAAGATGCAGCAGAAAGGG - Intronic
1039375512 8:37028753-37028775 TAGAAAACAGGCTGCACAGCAGG + Intergenic
1040302171 8:46193740-46193762 TGGAAAAGCGTCAACACAGCAGG + Intergenic
1040330669 8:46384173-46384195 GGGAGAAGAGGCAGGACAGCAGG + Intergenic
1040639901 8:49321127-49321149 AGGAAAAGATAAAGCTCAGCTGG + Intergenic
1040746516 8:50649526-50649548 TGGAAAAGCTCCAACACAGCTGG - Intronic
1041836290 8:62219652-62219674 TGGGAAATATGCAGCATAGATGG - Intergenic
1041964639 8:63661387-63661409 TGGAAGGGATGCAGAACAACAGG - Intergenic
1043046596 8:75331599-75331621 TGGCAAGGCTGCATCACAGCTGG - Intergenic
1044602809 8:94022610-94022632 TGGCAAAGATGCAGGGCAACTGG + Intergenic
1045070470 8:98499106-98499128 GGGAAAAGATGCTACACTGCTGG + Intronic
1046763927 8:118049484-118049506 TGGAAAAGAGACAGCACAAAGGG + Intronic
1047427174 8:124757297-124757319 CGGAAAAGATACATCACAGCTGG + Intergenic
1047994048 8:130316560-130316582 TGGAAAAGAAGTGGCTCAGCTGG + Intronic
1048698777 8:137060263-137060285 TTGAAAAGAAGTAGCAAAGCTGG + Intergenic
1049125341 8:140781938-140781960 CGGAAAGAAGGCAGCACAGCTGG + Intronic
1050269128 9:3923522-3923544 TGGAAAAGCAGCAGCACATTTGG + Intronic
1050938025 9:11423807-11423829 TGGACCACATGCAGCCCAGCAGG - Intergenic
1051396050 9:16622087-16622109 TGGAAATGATGAAGCTCAGGAGG - Intronic
1053666201 9:40319663-40319685 TGGAAAAGCTTCTGCCCAGCTGG - Intronic
1054377354 9:64459691-64459713 TGGAAAAGCTTCTGCCCAGCTGG - Intergenic
1054518408 9:66056620-66056642 TGGAAAAGCTTCTGCCCAGCTGG + Intergenic
1054921304 9:70545459-70545481 TGGAAAAGACACAGCACAGTGGG + Intronic
1055321083 9:75084137-75084159 GTGAAAAGGTGAAGCACAGCTGG + Intronic
1055845816 9:80562084-80562106 TAGAAAAGATGAAAAACAGCAGG - Intergenic
1056773599 9:89496874-89496896 TTGAAAAGACTCAGAACAGCAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058358178 9:104107622-104107644 TGAAAAAGAAGCCCCACAGCTGG - Intronic
1059071281 9:111139108-111139130 TGGAAAAGAAGAAGCATAGTTGG - Intergenic
1059094738 9:111400171-111400193 TGTAAGAGTTGCAGCACACCTGG + Intronic
1060695154 9:125703055-125703077 TGGAAAAGATGCTGGAAATCTGG - Intronic
1060909886 9:127341074-127341096 GGGAAGAGAGGCAGCCCAGCTGG - Intronic
1061370808 9:130196333-130196355 GGGGACAGATGCAGCAGAGCCGG - Intronic
1061481982 9:130901897-130901919 TGGAACAGATGCACCATGGCTGG - Intergenic
1185847495 X:3452095-3452117 TGCAAAAGATGCAGCAGTCCAGG + Intergenic
1185871709 X:3670182-3670204 TAGAAGAGAAGCTGCACAGCTGG + Intronic
1186433084 X:9521194-9521216 TGGAAAAGGAGCAGAACAGATGG + Intronic
1186635519 X:11400252-11400274 TGCAAAAGATGCATCACTGCAGG + Intronic
1186718722 X:12280037-12280059 TGGAAAATATGCAGTACATTGGG + Intronic
1188986262 X:36771102-36771124 GGGACAAGATACAGGACAGCAGG - Intergenic
1188989610 X:36801687-36801709 TTTAATAGCTGCAGCACAGCAGG - Intergenic
1189241863 X:39531245-39531267 TGGAAAAGATCCAGAAGAGTTGG - Intergenic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1192551223 X:72055276-72055298 TGGAGAAGATGCAGCAAGCCCGG - Intergenic
1193776632 X:85650328-85650350 CTGAAAAAATGCAGCACACCTGG - Intergenic
1194891792 X:99387904-99387926 TGTACAAGATGCAGCAAAGATGG - Intergenic
1195515902 X:105775494-105775516 AGGAAAATATTCAGCACACCTGG + Intergenic
1197985923 X:132266396-132266418 TAGAAACCAGGCAGCACAGCAGG - Intergenic
1199078772 X:143553142-143553164 TGGCAAGGAGGCAGAACAGCTGG + Intergenic
1199079057 X:143556126-143556148 TGGAAACTAGGCCGCACAGCAGG + Intergenic
1199148044 X:144394874-144394896 GGGAAAAGGTGAAGCAAAGCAGG + Intergenic
1199767794 X:150953562-150953584 TGAAAAAGAAGCAGTACAGGGGG - Intergenic
1199967933 X:152835167-152835189 TAGAAAAAATACAGCAAAGCAGG + Intronic
1200379558 X:155820297-155820319 TGCAAAAGTTGCAGCATTGCTGG + Intergenic
1202067111 Y:20951502-20951524 TGAAAAACAGGCAGCACTGCAGG - Intergenic